In this assignment, you are required to write a bash script, call it mycontainer.sh to do the following tasks: 1) Create an LXD container based on ubuntu. 2) Install the latest version of mysql on the container created in Step 1. Then, start the database and autostart it during future boots. 3) Print the process ID of the running database, then give this process the highest possible priority. 4 Inside the container, create a new systemd service to: Re-execute Step 3 to adjust the priority. Send a notification message to your AUIS email address(es). Call this new service ‘email-mysql.service’. 5) Adjust systemd to run the ‘email-mysql.service’ automatically once every six hours. 6) Lastly, include necessary Bash commands to upload your container to an ssh server with the IP address 192.168.1.1. Assume the username and password are 'auis' and 'pass123', res

In this assignment, you are required to write a bash script, call it mycontainer.sh to do the following tasks: 1) Create an LXD container based on ubuntu. 2) Install the latest version of mysql on the container created in Step 1. Then, start the database and autostart it during future boots. 3) Print the process ID of the running database, then give this process the highest possible priority. 4 Inside the container, create a new systemd service to: Re-execute Step 3 to adjust the priority. Send a notification message to your AUIS email address(es). Call this new service ‘email-mysql.service’. 5) Adjust systemd to run the ‘email-mysql.service’ automatically once every six hours. 6) Lastly, include necessary Bash commands to upload your container to an ssh server with the IP address 192.168.1.1. Assume the username and password are 'auis' and 'pass123', res

LINUX+ AND LPIC-1 GDE.TO LINUX CERTIF.

5th Edition

ISBN:9781337569798

Author:ECKERT

Publisher:ECKERT

Chapter7: Working With The Bash Shell

Section: Chapter Questions

Problem 5DE

See similar textbooks

Similar questions

In this final submission, you will build on checkpoint B to load the database and DNA sequence from files. There will be two databases and several sequences that will be available for download below. Example of the database is the file small.txt: name,AGATC,AATG,TATC Alice,2,8,3 Bob,4,1,5 Charlie,3,2,5 Example of the sequence is the file 1.txt: AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG Implement/modify the following functions: Modify the function readData, which will now take an additional parameter: a string representing the filename containing the database of individuals and their STR counts. It will also return a bool indicating if opening the file was successful or not: bool readData(string filename, vector<string>& nameSTRs, vector<string>& nameIndividuals, vector<vector<int>>& STRcounts) Update the function…
For this project you will have to build a web application for managing a support ticketing system (STS). The application must be implemented with PHP. You can use a relational database like MySQL. - Non-logged-in users should see a “Register” menu link on all pages, which leads them to the registration page - The registration process requires the user’s email, password, name and team - The email should be a valid email address and not exist in the system (two registered users cannot have the same email) - Passwords should be at least 6 characters long and should contain both letters and numbers - The team should be one of the following values: Development, Support, Sales - Proper validation should be performed by the system, and detailed error messages displayed - Non-logged-in users should see a “Login” menu link on all pages, leading to the login page - login page asks for user email and password.
Assuming you have created already created a MySQL database named "database_name" with a table named "users" that has columns for "username", "password", and "email". And that you have also created a login system that sets the "username" session variable when a user logs in.Write a simple PHP code that makes use of sessions, mysql insert, update, and delete. The code should first start with a session using session_start(). It should then connect to a MySQL database using mysqli_connect(). It inserts a new record into the users table using mysqli_query() and an SQL INSERT statement. It updates an existing record in the users table using mysqli_query() and an SQL UPDATE statement. It deletes a record from the users table using mysqli_query() and an SQL DELETE statement. It sets a session variable using $_SESSION["username"] and displays it using echo. Finally, it closes the MySQL connection using mysqli_close()
Write a script to check if the current user has any processes that have been running for more than one hour. If the process has ran for more than one hour, the script should kill the process. However, the script should not kill the bash shell (that the script is run from (or any others). Commands that you may need to use might include ps, tr, tail, cat, cut, paste, echo, expr, date and kill. Note: Your script must avoid killing all bash shells. Bash is most frequently listed in the results of ps as just bash, but can be listed as /bin/bash, or as part of a running script as /bin/bash script1.sh. It’s also possible that it is being run out of some nonstandard directory (like ~/bin/bash for a custom version). Note: This program will kill your graphical environment if you are using one. If you really want to see if it works, run it from console mode.
You will develop a client side and a Servlet program that will work with a database. 1. The client (front end) should have a title “NJIT Credit Union”, centered. 2. The client should have a background color. 3. The client should have a text field with label ‘UserID' where user will enter userID (integer) and a Submit button with text "Submit". 4. An unsuccessful authentication should have a message printed on the screen, in red, stating that "Your authentication has failed, please try again." (no pop up message). At this point the text field should get cleared and ready to accept a new input. Your program should not exit. 5. A successful authentication should be followed by a message on the screen, in green, stating that "Your authentication is successful" (no pop up message). 6. There should be two other text boxes with label "Deposit" and "Withdraw" where user will enter an amount (you should accommodate for decimals). These two text boxes should only be enabled after successful…
You are creating a database for storing information for a Netflix like service. The database stores movies with id, title, filename and TV shows with id, title. TV Shows have episodes. Each episode has a corresponding TV show, a season id, an episode id, title, filename. Some episodes have a next episode (i.e. the episode that will automatically start showing once the user finishes watching the current episode!). The database also stores users, each user has an id, username, password. Users may watch zero or more movies, zero or more TV show episodes. For each movie or episode, the database stores a watch time value for each user, indicating how many minutes the user watched that movie or show. Finally, the database stores which movie appears similar to which other movie for a given user (to be able to make recommendations). Construct an E-R diagram (based on a Chen's model) to represent the above requirements. Make sure you include all appropriate entities, relationships, attributes,…
Assume you are working with a remote repository. You want to get the most recent code from the remote repository, make changes, and upload them to the remote server. What should be the order of source control operations? pult commit, push O push commit, pull O pull push, commit O commit, pull, push O commit, push, pull O push, pull, commit
Scenario: You have been tasked with building a URL file validator for a web crawler. A web crawler is an application that fetches a web page, extracts the URLs present in that page, and then recursively fetches new pages using the extracted URLs. The end goal of a web crawler is to collect text data, images, or other resources present in order to validate resource URLs or hyperlinks on a page. URL validators can be useful to validate if the extracted URL is a valid resource to fetch. In this scenario, you will build a URL validator that checks for supported protocols and file types.
IN SSIS we have to load data from two sources. The first source is a table , the second is a flat file, delimited {CR}{LF}, ", | . We have to create a package to load the data from those two sources. However, some data is in different format and we have to union it. Also, we have to remove duplicates. How can we accomplish that?
What is the difference between git commit and git push ? A. push stores all staged changes in the local repository, commit sends all changes in the local repository to the remote repository B. There is no difference, they are just two names for the same thing C. commit stores all staged changes in the local repository, push sends all changes in the local repository to the remote repository D. push forces everyone else to immediately download your code, while commit only sends your changes to the remote repository without forcing everyone to download your code immediately
You are writing code for a webserver in JavaScript that should keep running at all costs. There is a risky function that queries a database that is unreliable. Write the code you would use to run the synchronous ‘checkDatabase()’ function in a way that does not crash the program if it fails.
Your company has grown significantly, and suddenly there is a significant increase in the usage of file servers. All of the file servers are in close proximity to the clients, and you're adding many more, resulting in a big group of servers. The number of namespace servers has also increased in recent years. Your original setup utilized the default options for the referral ordering mechanism and polling, which were both enabled. What modifications should you think about making?