List the possible interactions in proteins that would affect ∆G.
Q: 7. H 1 H-C -OH H-C-OH 1 H -C 8. H 9. НО I 1 H J=D 0=)) с HIV-H OH HH -C-C-H I OH OH F-DIE-DI - CH…
A: 7. Chemical formula for structure number 7. = C4H8O4 or C4(H2O)4. Yes, this structure is a…
Q: Choose the five correct labels for the figure Enzyme Active site Substrate binds at the enzyme…
A: Introduction Enzyme is a biocatalyst. Enzyme binds with the substrate to form enzyme substrate…
Q: The proton-motive force is a measure of the potential energy generated across the mitochondrial…
A: The electron transport chain (ETC) is a chain of electron carriers present in the inner…
Q: What is the total yield of NADH, FADH2, and acetyl-CoA from the complete oxidation of myristate?…
A: Myristic acid is a fatty acid with 14 carbon atoms. Beta-oxidation is the oxidation of fatty acid on…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids:
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Calculate the pI for the following peptide: Phe-Lys-Glu-Asp-Lys-Ser-Ala (note: there is only one…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: The activity of an enzyme can be regulated by a: A) competitive inhibitor binding to the active…
A: The enzymes increase the rate of biochemical reactions and can be regulated by binding to…
Q: Identify the type of chemical reaction. 1 R R 2 Fat / Oil C01695 -R 3 NaOH/H₂O heat Lye Linoleic…
A: Triglycerides are fatty acid esters of glycerols. Fatty acids are carboxylic acids with a long…
Q: 3. Given the following peptide sequence, GSICDNCR, the estimated net charge at the given pH is: a)…
A: Peptides: Organic substances known as amino acids include both amino and carboxylic acid functional…
Q: You are a research scientist studying miRNA processing. You currently know everything about the…
A: Dicer is also known as helicase with RNase motif. It belongs to RNAse III family. Dicer cleaves…
Q: The function of the Electron Transport Chain (ETC) in eukaryotic cells is to produce a proton…
A: In the electron transport chain (ETC), the electrons pass through four enzyme complexes, that…
Q: what are the molecular descriptors of phosphatidylinositol?
A: Phosphoinositides are the phospholipids comprising a water soluble head group i.e. myoinositol…
Q: Name 2 prominent secondary structure of protein,lable out 3 differences between them.
A: Proteins are the polymers of amino acids. They have four different levels of structural…
Q: Compare and contrast the biosynthesis of oleic acid via the aerobic and anaerobic route.
A: Oleic acid: Oleic acid, whose lipid number is 18:1 cis-9, is categorised as a monounsaturated…
Q: Gluconeogenesis occurs in muscle using the enzyme glucose-6-phosphatase. True False
A: The term "gluconeogenesis" describes a collection of metabolic processes that take place in the…
Q: In the peptide, SWEETLY, bond via its side chain. (Give the full name of the amino acids) can still…
A: Recall that: for a given peptide amino acid sequences are written with N-terminal amino acid on the…
Q: QUESTIONS: 1. Explain the role of dietary fat in atherosclerosis.
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Lactate dehydrogenase isoforms contain "H" and "M" subunits. In total, how many subunits are found…
A: - A dehydrogenase is an enzyme that transfers a hydride from one molecule to another. - Enzyme…
Q: Under aerobic conditions of high ratios of NADH/NAD+ and ATP/ADP, as pyruvate is utilized for its…
A: Pyruvate under Aerobic conditions: Pyruvate can diffuse into mitochondria under aerobic conditions,…
Q: Which metabolic event is not in the mitochondria? Oxidation of fatty acids ETC…
A: Glycolysis is a the pathway in which glucose is broken down into two three-carbon compounds and…
Q: i) Re-arrange with the Michaelis Menten equation so it involves the ratio [S] Show all steps…
A: Michaelis-Menten equation A mathematical model called the Michaelis-Menten equation is used to…
Q: The proton-motive force is a measure of the potential energy generated across the mitochondrial…
A: INTRODUCTION : Proton-motive force : It is a measure of the potential energy generated across the…
Q: Calculate the number of ATP molecules obtained from the anaerobic conversion of each of the…
A: Anaerobic metabolism is the process in which ATP is produced without oxygen, i.e. ATP is formed by…
Q: What is one technique or property of a protein that you could use to monitor the fractions so you…
A: In column chromatography, there is a stationary phase and the mobile phase. The stationary phase…
Q: In a healthy young adult, what may explain high levels of creatinine in serum and urine samples?
A: INTRODUCTION : Creatinine - It is a breakdown or by- product of creatine phosphate from muscles and…
Q: Give the corresponding class, subclass, sub-subclass, specific enzyme of the following E.C. codes.…
A: Enzymes are proteins which serve as catalyst for a biochemical reactions. It doesn’t get involved in…
Q: Which of the following statements is FALSE regarding oxidative phosphorylation? The pH is higher in…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…
Q: In gluconeogenesis, how is glucose-6-phosphate converted to glucose? is converted to glucose by…
A: Gluconeogenesis is a metabolic process that converts non-carbohydrate carbon substrates such…
Q: Which of the following statements is/are TRUE about the Lock and Key model of enzyme-substrate…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: DNA: what telomerase does and why it's necessary?
A: A telomere is the region at the end of a chromosome which contains a repetitive DNA sequence. DNA…
Q: where in the cell Electron transport chain and oxidative phosphorylation occur?
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: What is an example of RNA editing? Changing a valine codon to a stop codon Methylation of cytosine…
A: Nucleic acids like DNA and RNA can be edited in various ways. Editing is done for various reasons…
Q: What does bleach do to hair
A: Melanin, the pigment that also affects the colour of your skin, also determines the colour of your…
Q: Which statement is false for transition-state analog enzyme inhibitors? They fit the active site…
A: Transition state analogues are used as enzyme inhibitors. They bind competitively to the active site…
Q: reaction of glyceraldehyde-3-phosphate to form dihydroxyacetone phosphate
A: Glycolysis is a collection of 10 enzymatically catalysed reactions that sequentially oxidise a…
Q: Which of the following is NOT true of a competitive inhibitor? A) Its effects can be overcome by…
A: Competitive inhibitor- It competes with the substrate for the active site of an enzyme, while the…
Q: F.28. How will phosphorylation of serine change the pKa of Arg, increase, decrease, or no change
A: Serine is a polar but uncharged residue. Arginine is a basic residue due to the presence of an amine…
Q: Question 15 of 25 Which of the following is true for the acid-base properties of amino acids? Select…
A: The proteins are made of 20 naturally occurring amino acids. The net charge on the side chain of the…
Q: why is having a more reductive environment will alter the functional characteristics of alpha…
A: Keratin is a protein that is of two types: alpha and beta keratin. Alpha keratin is alpha helix…
Q: Can someone give me an understanding of Products and Reactants? The first image is from the the…
A: Chemical reactions are processes that convert reactants into products. Some of the chemical…
Q: A. Given the 7 proteins in the table, will they all be separated properly using isoelectric…
A: Proteins are high molecular weight biomolecules made up amino acid residues linked via a peptide…
Q: 5. In the early days of protein biochemistry, these proteins were described using "operational…
A: Operational definition is applicable to many things in our everyday life. It is most popularly used…
Q: . The book dived into allosteric enzymes and how they are regulated in metabolic pathways, but…
A: Michaelis Menten enzymes are those that follow MM kinetics. These enzymes have their reaction rates…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…
A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…
Q: What are the key differences between DNA synthesis (in the context of DNA replication) and RNA…
A: DNA is the genetic material. Replication is the process that copies the DNA to produce identical…
Q: 1. Consider the following: a) Name it. b) Using the three-letter symbols for the amino acids, how…
A: Peptides are composed of twenty standard amino acids. These twenty standard amino acids differ from…
Q: Although initiation requires the sigma factor or sigma subunit be associated with the core RNA…
A: Transcription is a process by which RNA is synthesized using DNA as template. Transcription occurs…
Q: Consider the enzyme, ATCase. All are true except: It's K effectors are ATP and CTP It is a K…
A: ATCase (Aspartate carbamoyltransferase) is an enzyme which catalyzes the first step of the synthesis…
Q: Studies of a specific enzyme activity showed that the time the enzyme activity before complete…
A: An organic substance called an enzyme acts as a catalyst for a biological reaction. Each cell in the…
Q: Indicate whether the following pairs of monosaccharides are aldoses or ketoses. a. D-altrose &…
A: INTRODUCTION : Monosaccharides : They are also known as simple sugar. They are the simplest forms of…
Proteins
We generally tend to think of proteins only from a dietary lens, as a component of what we eat. However, they are among the most important and abundant organic macromolecules in the human body, with diverse structures and functions. Every cell contains thousands and thousands of proteins, each with specific functions. Some help in the formation of cellular membrane or walls, some help the cell to move, others act as messages or signals and flow seamlessly from one cell to another, carrying information.
Protein Expression
The method by which living organisms synthesize proteins and further modify and regulate them is called protein expression. Protein expression plays a significant role in several types of research and is highly utilized in molecular biology, biochemistry, and protein research laboratories.
List the possible interactions in proteins that would affect ∆G.
Step by step
Solved in 2 steps
- Describe the forces that are involved in the tertiary structure of a protein and give an example of each force listed.Given the following pKa data for the individual amino acids, estimate the pI for the tripeptide Thr-Asp-Arg. N-terminal amino group = 9.10 Side chain of aa #1 = Side chain of aa # 2 = 3.86 Side chain of aa # 3 = 12.48 C-terminal carboxyl group = 2.01 PI =What sidechain residues stabilize binding of PSTMB in the LDHA structure? https://www.nature.com/articles/s41598-019-40617-3
- Describe the steric interactions that determine the conformations that pyrimidine nucleosides assume.Draw the titration curves for the following AA’s: Aspartic acid, Alanine, Lysine, Valine, Serine, and Trrosine.Consider the peptide Trp-Arg-Glu-Cys-Gly-Tyr. For the drawings requested below, please show them in zig-zag style, from amino to carboxy terminus, with correct stereochemistry Draw the predominant form at pH = 2 Draw the predominant form at pH = 5 Draw the predominant form at pH = 7 Draw the predominant form at pH = 12
- What is meant by denaturation of proteins? Give examples of protein denaturating agent?do a and e please and For e, choose two types of interactions, and then give an example of the amino acids in this polypeptide that would interact together in that way.Consider the peptides Pro-Gin-Val-Phe-His-Asp-Cys and His-Gln-Pro-Cys-Asp-Phe-Val. How do these two peptides differ? (Select all that apply.) The two peptides have different compositions. The two peptides have different isoelectric points. The two peptides have different titration curves. The two peptides differ in amino acid sequence. [References] If you were to have a mythical amino acid based on glutamic acid, but one in which the hydrogen that is attached to the y-carbon were replaced by another amino group, what would be the predominant form of this amino acid at pH 12 if the pK, value were 10 for the unique amino group? (Select all that apply.) Both of the carboxyl groups are deprotonated. The amino acid-carries a negative 2 charge. The amino acid carries a negative 4 charge. The amino groups are in the form -NH". Both of the amino groups are deprotonated.
- Based on the pK, table for amino acids (Table 1.1), draw the structures with net charge, and the equilibria representing the complete deprotonation of aspartate. Table 1.1 Name pK pk2 pKR Glycine Alanine 2.4 9.8 2.3 9.7 Valine 2.3 2.4 9.6 Leucine 9.6 Isoleucine 2.4 9.7 Methionine 2.3 9.2 Phenylalanine Proline Serine 1.8 9.1 2.0 10.6 2.1 9.2 Threonine 2.6 10.4 Cysteine Asparagine Glutamine 1.8 10.8 8.3 2.0 8.8 2.2 9.1 Tyrosine Tryptophan Aspartate Glutamate 2.2 9.1 10.9 2.4 9.4 2.0 2.2 10.0 3.9 9.7 4.3 Histidine 1.8 9.2 6.0 10.8 Lysine Arginine 2.2 9.2 1.8 9.0 12.5Briefly describe each of the following possible posttranslational protein modifications. Give an example of each. Cross-linkage glycosylation and phosphorylation cleavage assembly into polymeric proteins (> 1 polypeptide)TABLE 5.1 Properties of the common amino acids found in proteins pKa of lonizing Residue Mass Occurrence pKa of a-COOH Group a-NH3 Group pKa of Abbreviations 1- and 3-letter codes Name " Side Chaina (daltons) in Proteins (mol %) Alanine A, Ala 2.3 9.7 71.08 8.7 Arginine R, Arg 2.2 9.0 12.5 156.20 5.0. Asparagine N, Asn 2.0 8.8 114.11 4.2 Aspartic acid D, Asp 2.1 9.8 3.9 115.09 5.9 Cysteine C, Cys 1.8 10.8 8.3 103.14 1.3 Glutamine Q, Gln 2.2 9.1 128.14 3.7 Glutamic acid E, Glu 2.2 9.7 4.2 129.12 6.6 Glycine G, Gly 2.3 9.6 57.06 7.9 | Histidine Н, His 1.8 9.2 6.0 137.15 2.4 Isoleucine I, lle 2.4 9.7 113.17 5.5 Leucine L, Leu 2.4 9.6 113.17 8.9 | Lysine K, Lys 2.2 9.0 10.0 128.18 5.5 Methionine М, Met 2.3 9.2 131.21 2.0 Phenylalanine F, Phe 1.8 9.1 147.18 4.0 Proline P, Pro 2.0 10.6 97.12 4.7 Serine S, Ser 2.2 9.2 87.08 5.8 T, Thr W, Trp Y, Tyr Threonine 2.6 10.4 101.11 5.6 Tryptophan 2.4 9.4 186.21 1.5 Tyrosine 2.2 9.1 10.1 163.18 3.5 Valine V, Val 2.3 9.6 99.14 7.2 | Approximate valuoc…