Match each statement below with the correct RNA molecule. A. rRNA B. mRNA C. tRNA D. uRNA 1. Contains the codon 2. is read by the ribosome 3. contains the anticodon 4. Transport amino acids to the ribosome
Q: What molecule catalyzes the formation of proteins
A: The protein synthesis process is a process where amino acids are formed by reading the frame of the…
Q: Choose the combination of answers that most accurately completes the statement. Which of the…
A: Prokaryotes: - These are unicellular organism. Doesn't contain clearly defined nucleus or…
Q: e? A)A gene's promoter sequence is transcribed into mRNA. B)Translation begins at the 5′ end of a…
A: Transcription is the process of formation of mRNA from the DNA.and Translation is the process of…
Q: Is the RNA-coding sequence likely to be from a bacterial cell or from a eukaryotic cell? How can you…
A: The mRNA coding sequence doesn't contain non coding part (intron). Introns are transcribed to…
Q: If a tRNA molecule has an anticodon which reads AUG what was the codon of the mRNA MOLECULE
A: tRNA is also called a transfer RNA. It is a secondary structure of RNA having stem loops. It is a…
Q: What regulates the process of transcription and translation; compare and contrast these processes.
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA
A: Translation is the process by which proteins are synthesized by joining of amino acid using mRNA and…
Q: The anticodons are located in a.tRNA. b.rRNA. c.mRNA. d.ribosomes. e.endoplasmic reticulum.
A: Anticodons- An anticodon is a trinucleotide sequence complementary to that of a corresponding codon…
Q: Illustrate a hypothetical genetic code by spelling out the nucleotide codons of a segement of mRNA…
A: Genetic code is the triplet sequence of nucleotides in the gene or mRNA (messenger ribonucleic acid)…
Q: How are rare bases incorporated into tRNAs? a. Encoded by guide RNAs b. By chemical changes to one…
A: RNA contains four types of nucleotides adenine, guanine, cytosine, and uracil. In addition to these…
Q: 44
A: The given structure is of tRNA molecule which is an adapter molecules for amino acid synthesis.
Q: Use the figure to answer the question. 5' tRNAS , which are single-stranded, have what is described…
A: Introduction :- t-rna (transfer RNA) which is used in translation i.e protien synthesis.Its…
Q: Which description best fits the definition of a messenger RNA? a An RNA that encodes for a protein b…
A: RNA is a single-stranded nucleic acid that aids in protein synthesis in our bodies.
Q: Which of the following is a function of TRNA? O A) brings one amino acid to the ribosome B)…
A:
Q: Which scenario would NOT cause a change to the amino acid that is added to a polypeptide chain? a.…
A: m RNA codes for proteins. This process is called translation. mutation is change in the DNA…
Q: The ribosome is needed for translation of mRNA (a) because it has the enzyme that forms peptide…
A: Ribosomes are found on Rough endoplasmic reticulum of a cell (in eukaryotes) , which actively…
Q: Choose the DNA sequence from which this mRNA sequence wastranscribed: 5′-AUACGAUUA-3′.a.…
A: Ans: DNA: It is the life molecule which is known as Deoxyribonucleic acid. mRNA: The sequence of…
Q: Ribosomal RNA ____________________. a. Carries amino acids to the ribosome b. Carries information…
A: It is involved in the synthesis of proteins, carrying the instructions from the DNA , which itself…
Q: Treating a cell with a drug to stop tRNA from doing its job would mean what? A. that ribosomes…
A: Introduction Translation is the process through which a cell uses the genetic information conveyed…
Q: Use the codon table shown above to help answer this question. What protein sequence would a cell…
A: The mRNA sequence is: 5' CCAUGCACCAAUAGAUAACCG 3' The Codon is read in triplet form.
Q: Use the table to answer: A portion of an mRNA attached to a ribosome reads: 5′…
A: Ribosomes (macromolecular structure) composed of rRNA and polypeptide chains are formed of two…
Q: Define the following terms: a. wobble hypothesis b. aminoacyl-tRNA synthetase c. tRNA d. AUG…
A: Wobble hypothesis was proposed by scientist Crick mainly to explain the observed degeneracy in the…
Q: Ribosomes contain catalytic ________ molecules.
A: Answer - Option C - rRNA
Q: Which is true about eukaryotic cDNA? Choose all that apply a. it is single stranded b. it is made…
A: Complementary DNA is abbreviated as cDNA. This form of DNA has a wide range of applications. Genes…
Q: Transfer RNA ____________________. a. Carries amino acids to the ribosome b. Carries information…
A: The RNA is a biopolymer and the existence of complementary sequences on the RNA strand ensures that…
Q: _____________ are molecular machines that excise introns from pre-mRNA and then join exons together.
A: In eukaryotes, the RNA transcript that is formed by transcribing a DNA molecule is termed pre-mRNA…
Q: A ribozyme is a. a complex between RNA and a protein. b. an RNA that encodes a protein that…
A: RNA or ribonucleic acid is a single stranded molecule, which is formed after the transcription…
Q: Explain the types of RNA & explain how they play role in the process of protein synthesis.
A: Explain the types of RNA & explain how they play role in the process of protein synthesis.…
Q: Which process best describes the process of transcription? DNA strands open and both strands are…
A: 1. The process that best describes the process of transcription is: DNA strands open and one strand…
Q: During transcription, ___________________. a. A cell divides to make 2 new cells b. A cell divides…
A: Transcription small explanation is provided in the below step.
Q: Write the sequence of bases in the sense strand of DNA that would result in formation of that…
A: DNA is converted to RNA by the process of transcription by an enzyme known as RNA polymerase. The…
Q: Messenger RNA ____________________. a. Carries amino acids to the ribosome b. Carries information…
A: DNA is converted into mRNA, this process is known as transcription. mRNA is converted into protein,…
Q: Transfer RNA is the molecule thata. contributes to the structure of ribosomesb. adapts the genetic…
A: There are two types of nucleic acids. RNA and DNA. RNA stands for ribonucleic acid. There are three…
Q: What process is the P site in a ribosome most closely associated with? a. Binds the tRNA…
A: Ribosomes are complex cell organelles, which are composed of ribonucleic acid (RNA) and ribosomal…
Q: Use the codon table shown above to help answer this question. An original (wild-type) mRNA sequence…
A: The changes in the nucleotide sequence of DNA or RNA is known as mutation that can alter the…
Q: Choose the combination of answers that most accurately completes the statement. Which of these…
A: The largest and broadest category of all groups in the classification of life is known as domain. At…
Q: In a polyribosome, the polypeptides associated with which ribosomes will be the longest? a. Those at…
A: Ribosomes are involved in translation by building proteins from amino acids using messenger RNA as a…
Q: In elongation, the creation of peptide bonds between amino acids is catalyzed by a. rRNA. b. a…
A: We know that the process of translation involves formation of protein from the mRNA (messenger…
Q: Define the following terms: a. rRNA b. tRNA c. mRNA d. siRNA e. miRNA
A: The nucleic acid is a significant macromolecule that is found in all living constituents. The…
Q: Use the figure of a tRNA to answer the following question: -E D Aminoacyl TRNA adds an amino acid to…
A: RNA is a type of nucleic acid present in the cells.
Q: RNA polymerase adds ribonucleotides
A: the correct answer is option number 1,that is 3'; phosphodiester.
Q: Which form of RNA acts as a blueprint for protein synthesis in the ribosome? a. tRNA O b. rRNA O c.…
A: Introduction Proteins are complex biomolecules and macromolecules that are made up of one or more…
Q: This model represents protein synthesis since the TRNA is delivering amino acids to form a…
A: The two main steps involved in protein synthesis are: transcription and translation. These two…
Q: Speculate why the half-life of mRNA is short, while the half-lives of rRNA and tRNA are long.
A: RNA is a genetic material and basically are of three types rRNA, mRNA and tRNA.
Q: Use the model to answer the following questions. 1. Which of the arrows (1 or 2) represents…
A: Transcription is the process of formation of mRNA on DNA template catalyzed by RNA polymerase.…
Q: After RNA polymerase binds to DNA, it begins making mRNA. What is the name of this process?
A: According to the central dogma, the most common arrangement of information in our cells is: Making…
Q: During translation, __________________. a. A cell divides to make 2 new cells b. A cell divides to…
A: Cell is the basic structural and functional unit of life.
Match each statement below with the correct RNA molecule.
A. rRNA
B. mRNA
C. tRNA
D. uRNA
1. Contains the codon
2. is read by the ribosome
3. contains the anticodon
4. Transport amino acids to the ribosome
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNAWrite a sentence describing the role of each of the following types of RNA in gene expression. mRNA- rRNA- tRNA- snRNA-Which of the following BEST describes the characteristics and function of siRNA? A. a short strand of RNA that can complement and inactivate a sequence of mRNA B. a short strand of RNA that can act as a transcription factor to initiate transcription C. a strand of DNA that can bind to and inactivate an mRNA sequence D. a tRNA that is not able to attach to a ribosome and therefore inhibits the process of translation
- Which of the following is the action of SnRNA (snurps)? a. Knocks out a portion of the gene b. Splices the introns out of m-RNA c. Splices out the exons out of m-RNA d. Important in growth and developmentWrite the polypeptide sequence that would be translated from your mRNA sequence. Use single-letter amino acid codes.During RNA splicing a. All exons are removed and degraded in the cell b. mRNA is made from DNA template c. Introns are removed from the mRNA and the exons are spliced together d. mRNA is translated into a protein molecule
- The portion of a gene that will be expressed in a protein is called a(an) a. Exon b. Intron c. promoter d.TATA boxSelect the most complete list of correct structures involved in the process of transcription a. mRNA, amino acids, ribosomes, polypeptide chains b. DNA, mRNA, RNA polymerase, a promoter c. mRNA, polypeptide chains, RNA polymerase d. DNA, mRNA, amino acidsThe anticodon a. is present in the tRNA and complementary to the codon in mRNA b. is present in the mRNA and binds to the codon c. is present in the tRNA and complementary to the amino acid d. is responsible for charging the tRNA
- A scientist is interested in producing flowers with a darker red color. To do this, the scientist alters the promoter of the gene to make it more active. This results in increased transcription and increased red pigments. The scientist then alters the promoter to make it even more active. This results in white flowers with no red pigment. Genetic research showed an increase in the siRNA in the cell. What did the siRNA do to the mRNA? A. The siRNA caused the mRNA to be broken down. B. The siRNA caused alternative splicing of the mRNA. C. The siRNA caused increased methylation of the mRNA. D. The siRNA caused the ribosome to no longer recognize this mRNA.Number the following steps of protein synthesis in the order in which they occur, starting with 1 and ending with 9.a. _____ The stop codon is reached, and the polypeptide is released.b. _____ The small ribosomal subunit finds the start codon, and the large ribosomal subunit joins.c. _____ The end of the gene is reached, and the pre-mRNA is released and then edited.d. _____ The transcription factor binds the promoter.e. _____ The protein is folded and modified to become functional.f. _____ RNA polymerase builds the mRNA transcript.g. _____ mRNA and initiator tRNA bind the small ribosomal subunit.h. _____ New tRNA molecules are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site.i. _____ mRNA exits the nucleus via a nuclear pore.A binding site for RNA polymerase is called a .a. gene c. codonb. promoter d. protein