Q: What is the name of the new antibiotic produced by Eleftheria terrae that was identified using the…
A: Antibiotic kills bacteria. It is used to prevent bacterial infection. In different parts of…
Q: why is testing known inhibitors of viral proteases from other viruses a logical first step in…
A: Protease in Corona virus cleaves the polyprotein in virus at 11 conserved sites. It is a kind of…
Q: A child has sex-linked color blindness, however both parents have normal color vision Please…
A: Color blindness is the X-linked recessive disorder that means it is inherited X-chromosomally and…
Q: The allele for color-blindness is carried on the X chromosome. Making color blindness (a recessive…
A: The inability to identify certain colour distinctions is known as colour blindness. The retina, the…
Q: Ascariasis is caused by Ascaris lumbricoides. Which type of organism causes this disease? O…
A: All the animals belongs to the kingdom Animalia. This kingdom consist of different phylums.…
Q: Does cellular respiration occur in the cytoplasm or in the mitochondria? Explain and answer in…
A: cellular respiration, the process by which organisms combine oxygen with foodstuff molecules,…
Q: Why is the pH of the blood stream lowered during intense exercise? How do muscles obtain MORE oxygen…
A: During intense exercise, our muscles undergo anaerobic respiration due to less availability of…
Q: Eukaryotic messenger RNA includes a poly A tail. When the poly(A) tail is less than approximately 30…
A: Introduction Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that, in molecular…
Q: 2. By what process does the carbon dioxide in the phenol red move into the plant exposed to light?
A: Phenol red is a pH indicator dye. Indicator dyes are pH sensitive and change colour when the pH…
Q: If a woman is heterozygous dominant and her husband is recessive for a genetically inherited trait…
A: A diploid organism having two different types of alleles is said to be heterozygous. Individuals…
Q: dominant that is 80% penetrant. Clara inherited her polydactyly from her mother, her father had no…
A: 80% penetrant means that in spite of the presence of the dominant allele still 20% people would not…
Q: In the biotechnology industry, lysine is produced by fermentation using which of the following?…
A: Lysine is a alpha amino type of amino acid which is precursor for many proteins. It contain alpha…
Q: Compare exons and introns. What are their significance and role in the genome organization of…
A: Introduction :- A gene's exon is a coding region that houses the data needed to produce a protein.…
Q: g Toll-like receptor
A: Macrophages work as innate immune cells through phagocytosis and sterilization of foreign substances…
Q: Assume that an organism has 400 V and 10 J light chain gene segments and 400V, 10 D, and 10 J heavy…
A: Introduction The rearrangement of V, D or J combinations results in the formation of the V region of…
Q: Do phantom perceptions arise from erroneous neural signals from an amputated stump, or from residual…
A: This phenomenon is related to the conscious feeling of the presence of a missing body part like a…
Q: Which one of the options below best describes where the water column meets the sea floor? The…
A: Depending upon the light availability and depth ,there are different zones categorised in the marine…
Q: Where does auditory information cross to the contralateral side of the body? What mechanism does the…
A: The auditory system interprets how humans hear and comprehend environmental noises. It consists of…
Q: Completely pubescent (60 hairs/cm³)? Intermediate pubescent (30 hairs/cm)? With 40 hairs/cm²?…
A: Polygenic traits are characteristics controlled or influenced by more than two genes. The genes have…
Q: Which of the statements is true? O Food spoilage is a common source of human infections O Food…
A: Answer :- Option (B) is correct. - Food spoilage makes the food appear, taste or smell different.
Q: You set up a cross between a male fruit fly with lobe eyes and a true breeding female fruit fly with…
A: Introduction:- A set of an organism's observable qualities or characteristics is known as its…
Q: structure of GLB-1 with haemoglobin and myoglobin, describe in detail why and how GLB-1 has…
A: Beta-galactosidase-1 is an enzyme that aids in the breakdown of lactose while hemoglobin and…
Q: I. II. III. IV. 2 1 2 3 2 3 4 3 4 S 4 4 6 5 5 Hemophilia Color blindness 6 5. If IV. 1 were to have…
A: Haemophilia is a rare type of disease where clotting of blood dosent occur in a normal way. It is a…
Q: Select all statements that correctly describe hemoglobin and myoglobin structure. By itself, heme is…
A: Introduction Myoglobin stores oxygen, whereas haemoglobin transports it. Red blood cells found in…
Q: the interactions of microorganisms with each other and/or with their physical environment contribute…
A: Introduction Microorganisms are too small to observe with naked eye. We need microscope to observe a…
Q: Joanne has AB blood and Henry has AB blood. They have one child with A blood, one child with AB…
A: Introduction The ABO blood group system divides all people into one of eight blood types based on…
Q: How are hypersensitivity disorders detected, prevented, and treated?
A: Hypersensitivity have a extreme stimulation of the senses, i.e. Sight, Hear, taste, smell, touch.…
Q: Why death is a surprise?
A: Death can be described as an irreversible natural change that can be described as a cease of all…
Q: The order of ducts in the male genital system: Select one: a. Tubuli recti- Rete testis- Vasa…
A: The genital duct system, which transports the spermatozoa and fluid component of the semen to the…
Q: 2.Once ovulution occurs. the corpus luteum.... which of the following contributes the function of…
A: Introduction The female reproductive system's uterus and ovaries undergo a series of physiological…
Q: Can you please explain the diagram it has lots of parts and can you explain in simple terms as to…
A: Thyroid hormone is important in the regulation of metabolic rate and also in maintaining lipid…
Q: Differentiate between RFLP and RAPD. Describe the usefulness of each technique
A: Introduction A quick, PCR-based technique for detecting DNA variation is called random amplified…
Q: What type of muscles are these Type 1, Type 2a or 2b? A. orbicularis oculi, Buccinator and platysma…
A: The main purpose of the muscle, which is a soft tissue in the body, is to provide power. Movement is…
Q: Two animals of the same______ are able to breed to produce fertile offspring. A.Class B• Genus ©…
A: The relative position of an organism group (a taxon) within a taxonomic hierarchy is known as…
Q: Contrast ST and NST in humans and non-human animals. Why does Marchand (or any other evidence)…
A: The process through which organisms produce heat is known as thermogenesis. It is found in all…
Q: the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the…
A: The process of formation of messenger RNA with the help of template strand of DNA is called…
Q: What if three genotypes have different fitness levels, so that both kinds of homozygotes are more…
A: Fitness is a quantitative measure of individual reproductive success. It is also equal to the…
Q: Staphylococcus aureus excretes a food poisoning toxin which, when ingested, produces nausea and…
A: Introduction: Streptococcus aureus has recognized as the most bacteria that cause disease in…
Q: 5. Very happy Escherichia coli cells reproduce on a 20 minute time frame (doubling or generation…
A:
Q: Use the following information to answer the next question. The end product of glycolysis reacts…
A: The process of converting chemical energy from nutrients into adenosine triphosphate in an…
Q: Explain four clinical symptoms on the human that expose to the etiologic agent in food.
A: Etiological agents are defined as the infectious substances containing microbes or pathogens and can…
Q: Is protein synthesis necessary for short-term synaptic plasticity, long-term synaptic plasticity, or…
A: INTRODUCTION Synaptic plasticity This is the modifications in strength of synaptic transmission that…
Q: What properties are gained during tumor progression that contribute to malignant behavior and…
A: The cells normally divide to replace the worn-out cells and died via a process called apoptosis.…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…
A: Given DNA strand: 5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'
Q: What are the usual cellular responses to reversible injury?
A: Introduction: Injury frequently connotes physical hurt, but it can also be used more allusively to…
Q: Biology Question
A: Colour It is the visual perceptual property deriving from the spectrum of light interacting with…
Q: How do type I, II, III, and IV hypersensitivity reactions differ according to the immune cell types…
A: Introduction: Exaggerated immune reactions to allergens are known as hypersensitivity reactions.…
Q: How do the etiologic processes of primary and secondary immune deficiency disorders differ?
A: Immune system is one of the physiological systems inside the body whose main function is to fight…
Q: Answer the following questions. How many types of tourniquets are there? Which is appropriate for…
A: Disclaimer: - According to Bartleby guidelines, only the 1st question can be answered. Please repost…
Q: sequence of amino acids.
A: The central dogma of molecular biology is the concept which explains the flow of genetic…
Match the Proteins (amino acid sequences) with the correct
Trait # 1: body style
# 2: Body covering
#3 legs
#4 Arms
#5 Head shape
a. Square Head
b. round head
c. Thin body
d. two legs
e. hairless body
f. two arms
g. normal body style
h. plump body style
I. one arm
j. three legs
k. three arms
m. one leg
Step by step
Solved in 2 steps
- What equipment or apparatus is used to measure a poultry's... a. Egg weight b. Haugh unit c. Yolk color d. Shell thickness e. Long circumference f. Short curcumferenceA mutation in the control region of a Hox gene that is normally expressed in the thorax causes the Hox gene to be expressed in the abdomen. What is a possible consequence of this mutation? ANSWER CHOICES A. Group of answer choices B. Eyes growing on the thorax C. Legs growing on the head D. Eyes growing on the abdomen E. Legs growing on the abdomenYou see the results of an eye-tracking study in which infants were required to look at human faces. You see that infant A spent most time looking at the contour of the face, while infant B spent a lot of time looking at the eyes and the mouth. You conclude that infant B is most likely: a.Bilingual b.Showing signs of a developmental disorder c.Younger than infant A d.Older than infant A
- What are some of the key behavioral and morphological characteristics of early domesticated dogs compared to their wild counterparts? Select ALL that apply. (Note: You will need to also watch the segment about foxes for the answer(s).) A. Higher Intelligence B. Improved Sense of Smell C. Higher Human Tolerance D. Shorter Snouts E. Narrow Skulls5a) Your textbook points out that the pecten is a structure that is very similar in many bird species. Does this mean that mutations that affect the structure and the function of the pecten occur less than mutations that affect other body parts? Why or why not?1a 1b 2a 2b 3a 3b 4a 4b 5a 5b Solitary bat. Colonial bat. >35-cm wingspan 35-cm wingspan <35-cm wingspan. Bat Dichotomous Key Reddish brown colored fur. Light colored fur..... Large, round ears. Short, pointy ears.... Go to 2 .Go to 3 .Hoary bat Go to 4 Big brown bat Go to 5 Seminole bat .Eastern red bat ..Mexican free-tailed bat ...Cave myotis bat Based on the dichotomous key above, what bat is being described? Observed traits: A bat that flew out of a cave containing a colony of bats was noticed to have a very small wingspan (only 20 cm) reddish fur, and pointed ears. Most like bat being observed:
- Which of the following phenotypes would most likely be the result of aHox gene mutation? a. abnormal body length or height b. two different eye colors c. the contraction of a genetic illness d. two fewer appendages than normalDiscuss how would you improve our Philippine native pig. Use principles related to animal breeding. Answer in 4 sentences only.In animals, Hox genes activate proteins to determine A. animal cephalic region B. animal physiology C. animal body plan D. animal caudal region E. animal reproduction
- Select one: O a. O b. O c. O d. O e. Small birds mutating their beak genes with the result that later- generation offspring have larger beaks. Small birds anticipating the long drought and eating more to gain weight and, consequently, growing larger beaks. Small birds gaining larger beaks by exercising their mouth parts. Larger birds eating less so smaller birds can survive. More small-beaked birds dying than the larger-beaked birds. The offspring produced in subsequent generations have a higher percentage of birds with large beaks.On average, Black Americans have shorter life expectancies than White Americans. Which of the following contributes to this difference? A. In recent years, alcohol and opioid abuse have had the biggest impact on life expectancies for Black Amerians relative to any other racial or ethnic groups. B. Black Americans are more likely to have regualr cancer screenings and so have a higher recorded incidence of cancer. C. The youngest generations of Black American are less health than older generations, so health amoung Black Americans has been getting worse over time. D. Black Americans ten to receive lower-quality care and spend less time with medical practitioners than White Americans do.7. Choose the answer that best completes the sentence below. Temple Grandin, an animal welfare advocate, notes that breeding animals for size and strength interferes with natural animal processes. ___________________, breeding roosters for muscle can make them top-heavy and unsteady on their feed, interfering with their courtship dances. a) For example b) As a result c) Most importantly d) In contrast