Multiple choice 1.) An Action potential A. is essential for nerve impulse propagation B. involves the influx of negative ions to depolarize the membrane C. involves the outflux of negative lons to depolarize the membrane D. Involves the outflux of positive ions to depolarize the membrane 2.) Which function can be carried out by DNA replication proteins? A. Topoisomerases wind the DNA into a double-helix. B. DNA ligase can initiate new DNA chains C. SSB converts double-stranded DNA into single-stranded DNA. D. Helicases break hydrogen bonds in the DNA. 3.) Which mechanism contributes to accuracy during DNA replication? A. The mismatch repair system recognizes an incorrect base-pair and corrects the mistake in the non-methylated strand. B. Using primers increases accuracy because the first nucleotides in a new nucleic acid chain are more likely to be correct. C. All DNA polymerases have a 5'-3' exonuclease activity which can remove incorrect nucleotides during replication. D. Base-stacking between nucleotides and the template DNA controls insertion of the correct nucleotide.

Multiple choice 1.) An Action potential A. is essential for nerve impulse propagation B. involves the influx of negative ions to depolarize the membrane C. involves the outflux of negative lons to depolarize the membrane D. Involves the outflux of positive ions to depolarize the membrane 2.) Which function can be carried out by DNA replication proteins? A. Topoisomerases wind the DNA into a double-helix. B. DNA ligase can initiate new DNA chains C. SSB converts double-stranded DNA into single-stranded DNA. D. Helicases break hydrogen bonds in the DNA. 3.) Which mechanism contributes to accuracy during DNA replication? A. The mismatch repair system recognizes an incorrect base-pair and corrects the mistake in the non-methylated strand. B. Using primers increases accuracy because the first nucleotides in a new nucleic acid chain are more likely to be correct. C. All DNA polymerases have a 5'-3' exonuclease activity which can remove incorrect nucleotides during replication. D. Base-stacking between nucleotides and the template DNA controls insertion of the correct nucleotide.

Essentials of Pharmacology for Health Professions

7th Edition

ISBN:9781305441620

Author:WOODROW

Publisher:WOODROW

Chapter14: Antineoplastic Drugs

Section: Chapter Questions

Problem 11CRQ

See similar textbooks

Similar questions

a. Pfu Polymerase b.dNTPs c.Buffer Match each component above to the correct function(s) listed below. Write your selection(s) for each component. You may have more than one answer for each. 1. unwinds DNA 2. synthesizes new DNA strands 3. enzymatically catalyzes Quikchange 4. nucleotide source for new DNA strands 5. Energy source for reaction(s) 6. Repairs errors in base pair matching 7. Maintains pH and salt levels 8. Creates polymer chains
b. The diagram below is of a short stretch of prokaryotic chromosomal DNA in the process of replication. Please supply the specific pieces of information requested by the boxes below. 1. What enzyme relaxes the supercoils? 2. What enzyme unwinds the DNA? 7. What does this arrow represent? 3. What enzyme synthesizes the RNA primer 8. Why should this single-stranded portion be stabilized? 4. What is this short segment of DNA called? 9. What enzyme synthesizes this long DNA segment? 5. What enzyme removes the RNA primer and replaces it with DNA? 10. Is this the leading or the lagging side? 6. What enzyme joins the short segments of DNA together? 3
Some antibiotic drugs fight infection by interfering with DNA replication, transcription, or translation in bacteria. Indicate whether each of the following antibiotic drug effects is on replication, transcription, or translation. HINT Each answer (replication, transcription, and translation) is used only once for the following: a. Rifampin binds to bacterial RNA polymerase. b. Streptomycin binds bacterial ribosomes, disabling them. c. Quinolone blocks an enzyme that prevents bacterial DNA from unwinding.
a. RNA Polymerase b. DNA Polymerase I c. DNA Polymerase III d. Single Strand binding protein e. Sigma Factor f. Ligase g. Peptidyl transferase h. Primers i. Aminoacyl synthetase j. Gyrase k. Release factors I. Rho factors m. AUG-fmet n. Initiation Factors Identify the following: 1. Catalyzes peptide bond formation between amino acids 2. Binds the amino acid to tis corresponding TRNA 3. Recognizes terminator region 4. Relaxes the tension created by the unwinding process. 5. Complements DNA nucleotides with RNA nucleotides. 6. Complements DNA nucleotides with deoxynucleotide triphosphates. 7. Recognizes UAA, UAG, UGA
3) Why are single strand binding proteins (ssb proteins) needed in DNA replication? (note that you need to explain WHY ssb proteins are important, not just what they do)
Section B: True / False (5 marks) 1. Primase has a DNA dependent RNA polymerase activity. 2. 7-methylguanosine cap is added to the 5' end of the DNA after replication in eukaryotes. 3. snRNA is produced in transcription. 4. Initiator tRNA enter ribosome with the help of EF-Tu. 5. At low oxygen partial pressure Po2, myoglobin has lower oxygen affinity than hemoglobin.
Q: reorder the steps of DNA reparation: A. Connection of an undamaged DNA strand and a newly synthesized B. Removal of the damaged area C. Determination of the location of damage D. Completing the damaged chain E. Attachment of DNA polymerase β to the 3'-end of the damaged strand
A.) There is no change in the DNA sequence if nucleotides are added or removed, it will have no effect to the cell. B.) Mutations in the DNA sequence are all irreversible. A. Statement A is correct B. Statement B is correct C. Both A and B are correct D. Both A and B are incorrect
Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…
Match the enzymes provided from (1-4) in the list of choices with their matching function (A-D) during DNA replication. A. Disrupts hydrogen bonds between DNA bases B. Can only add nucleotides to an existing 3 OH end C. Can't add nucleotides to a chain, but can make covalent bonds D. Actually a specialized form of RNA polymerase select 1. DNA polymerase select 2. Primase select 3. Ligase select v 4. Helicase
1. Describe the process of autophosphorlyation 2. Differentiate between chromosomes and genes. 3. Think about what happens at the replication fork. If the gene for helicase is mutated, what part of replication will be affected and how? 4. There are three common types of chemical changes that can damage DNA at any time post-replicatively. In basic terms, name and describe any two of the three types of damage. please help me quick
Match each enzyme name in the left column with the correct descriptive phrase in the right column. a. Topoisomerase II b. DNA ligase c. DNA polymerase y d. Reverse transcriptase i. Catalyzes most nucleotide incorporations in bacterial DNA replication ii. Cleaves RNA in a DNA-RNA hybrid molecule e. DNA polymerase I f. DNA polymerase II iii. Uses a tRNA primer in synthesis of retroviral DNA iv. Acts through an adenylylated DNA inter- mediate v. Catalyzes formation of a double-strand DNA break vi. Catalyzes mitochondrial DNA replication