O A. cutting out a DNA sequence. B. changing a DNA sequence. C. reinserting DNA into living organisms. D. recombinant plasmid gets inside a bacterial cell E. DNA polymerases are used to seal the bonds between fragments O O

O A. cutting out a DNA sequence. B. changing a DNA sequence. C. reinserting DNA into living organisms. D. recombinant plasmid gets inside a bacterial cell E. DNA polymerases are used to seal the bonds between fragments O O

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 3TYK: Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning...

See similar textbooks

Similar questions

Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning vectors? a. The plasmid must have resistance to accept DNA inserts. b. They allow the detection of plasmids that contain an inserted DNA fragment. c. They ensure the presence of the ori site. d. They ensure that the plasmid can be cut by a restriction enzyme. e. They allow identification of bacteria that have taken up a plasmid.
Q: Hyperglycosylated genetically engineered proteins synthesized by some micro-organisms are usually induce human immune system O True a O False .b Q: Find the incorrect statement about plasmids CO they are circular a they replicate independently .b they are transferrable .c they are single stranded .d Q: Discontinuities of DNA nick can be fixed by ........... activity Nuclease .a Modifying enzymes .b O Ligase .c O Polymerisation d Q: Frameshifts means missreading of right sequence of a inserted genes presence of mutation that disturb the b sequence order a process that leads to generate .c different protein sequence All choice .d none of choices.e Q: Despite some drawbacks, E. Coli remains the most frequently used microbial eukaryote for recombinant protein synthesis O True .a O False .b Q: Even when the recombinant proteins are produced in mammalian cells, there are still some drawbacks can be occurred such as Protein folding a The yield of recombinant protein b Recombinant Protein…
What is the correct order for the steps of transformation given inthe following list?1. Recombination with the bacterial chromosome2. Binding of a large DNA fragment to the surface of a bacterialcell3. Cutting a large DNA fragment into smaller pieces4. Uptake of DNA into the cytoplasm5. Degradation of one of the DNA strandsa. 1, 2, 3, 4, 5b. 2, 3, 5, 4, 1c. 2, 3, 4, 5, 1d. 2, 5, 4, 3, 1
4. In two isolates (one is resistant to ampicillin and theother is sensitive to ampicillin) of a new bacterium,you found that genes encoding ampicillin resistanceare being transferred into the sensitive strain.a. How would you know that gene transfer is takingplace?b. To determine if the gene transfer is transformationor transduction, you treat the mixed culture of cellswith DNase. Why would this treatment distinguishbetween these two modes of gene transfer? Describethe results predicted if the gene transfer is transformation versus transduction.c. To determine if the gene transfer involves transformation, conjugation, or transduction, you separatethe ampicillin-resistant and ampicillin-sensitivestrains by a membrane with pores that are smallerthan the size of a bacterium, but larger than thesizes of bacteriophage or DNA fragments. If genetransfer is still observed, what mechanisms arepossibly involved and which are excluded?
4. In bacterial cells, nucleotide excision repair involves which of the following proteins?A. DNA glycosylaseB. AP endonucleaseC. photolyaseD. AlkBE. UvrABC proteins 5. If Meselson and Stahl had results from density gradient analysis of bacterial DNA that indicated only two bands, one of the original density and one that was the same as unlabeled DNA, and no intermediate density band, this would indicate that DNA replication is:A. constructiveB. semiconservativeC. conservativeD. consecutiveE. cannot determine from the information given 6.In E. coli, which DNA polymerase is primarily responsible for filling in the gaps in the DNA generated during nucleotide excision repair?A. DNA polymerase IB. DNA polymerase IIC. DNA polymerase IVD. DNA polymerase VE. none of the above
Q: Antibiotics are used in genetic engineering. They are useful to keep culture free of microbial a O infections O to select healthy vectors .b O to identify replication start sites.c O as selectable markers .d Q: Choose the best choice that describes the purpose of adding chloramphenicol to the culture of engineered bacteria O It inhabits the process of protein a synthesis O It blocks chromosome replication .b It blocks cell division .c It leads to increase the copy number of d recombinant molecules Q: Alkaline denaturation process is a kind of DNA isolation on the basis of conformation, that cause insolubility of cell components except one of the following Supercoiled DNA a Chromosomal DNA b Protein molecules c RNA molecules d All choices.e None of choices f Q: After transforming the ligation mixture into the E. coli, the transformed and non- transformed bacteria both can grow on media .containing antibiotics True a O False ..b
4. What is the name of the process by which bacteria pick up a different organism’s geneticmaterial?5. Genetically, how does the original bacterial DNA (plasmid) differ from the final bacterial DNAmolecule? (Do not say, “It is longer.”)6. Tetracycline is an antibiotic that is prescribed to kill bacterial infections. The transformedbacterial cell that you created has the tetracycline resistant gene in it. If this cell is placed on agrowth medium with tetracycline, will the bacteria grow or die? Explain.
5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?
22.124 Give two reasons why bacterial cells am wred for recombinant DNA procedures. Nucleic Acids 1015 22.125 What role do plasmids play in recombinant Polymerase Chain Reaction (Section 22.15) 22.131 What is the function of the polymerase chain DNA procedures? 22.126 Describe what occurs when a particular restric- reaction? tion enzyme operates on a segment of double- stranded DNA. 22.127 Describe what happens during transformation. 22.128 How are plasmids obtained from E, coli bacte- 22.132 What is the function of the enzyme DNA polymerase in the PCR process? 22.133 What is a primer and what is its function in the PCR process? 22.134 What are the four types of substances needed to carry out the PCR process? ria? 22.129 A particular restriction enzyme will cleave DNA Sequencing (Section 22.16) DNA between A and A in the sequence AAGCTT in the 5'-to-3' direction. Draw a dia- gram showing the structural details of the "sticky ends" that result from cleavage of the following DNA segment.…
Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and indicate whether those pieces would have blunt or sticky ends. NOTE: in the given recognition sites, the dash represents where the cut is made. a) HpaI, recognizes 5’ GTT – AAC 3’ 5’ GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3’ 3’ CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5’ Number of fragments of DNA:…
8. Which of the following is the complementary base pairing of the DNA sequence 5' ATTCGGCTTA 3'? a. 3' TAAGCCGAAT 5' b. 3' ATTCGGCTTA 5' c. 5' TAAGCCGAAT 3' d. 5' ATTCGGCTTA 3' 9. Why is DNA polymerase I used in prokaryotes? a. to repair damage to DNA base pairs b. to remove DNA sequences to form plasmids c. to fill in gaps between Okasaki fragments along the lagging strand d. to add DNA nucleotides to build new strands 10. Which set of labels is correct for the following diagram of DNA replicating? E Z A T C ATAGAC direction of replication C a. b. Alignment Paired Y C. d. Anti-parallel AATA GTT D a. X is helicase, D is ligase, and E is leading strand. b. X is gyrase, Z is leading strand, and D is single-strand bonding proteins. c. X is helicase, Y is replication fork, and D is single-strand bonding proteins. d. X is topoisomerase, Y is replication fork, and E is leading strand. 11. What term is used to describe the direction by which the backbone of DNA strands run to each other?…
8. Using recombinant DNA techniques (which willbe described in Chapter 9), it is possible to take theDNA of a gene from any source and place it on achromosome in the nucleus of a yeast cell. Whenyou take the DNA for a human gene and put it into ayeast cell chromosome, the altered yeast cell canmake the human protein. But when you remove theDNA for a gene normally present on yeast mitochondrial chromosomes and put it on a yeast chromosome inthe nucleus, the yeast cell cannot synthesize the correctprotein, even though the gene comes from the sameorganism. Explain. What would you need to do to ensurethat such a yeast cell could make the correct protein?