Part A The bacterial gene little protein (lilP) makes a small protein of 11 animo acids (AA) in length. The DNA sequence of the lilP gene is shown below. 5'-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACTAGaaatattatttaa-3' 3'-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGATCtttataataaatt-5'
Q: Your friend wants to develop a new method to map the transcription start and end sites of a target…
A: Transcription is the process by which genetic information in DNA is used to synthesize RNA…
Q: Touching each other means what?
A: In human literature, sexual motivation—also known as sexual desire—refers to the likelihood of…
Q: Compare and contrast the pharmalogical history of cocaine and amphetamines?
A: Cocaine is a stimulant substance that has a strong effect on the central nervous system. It is…
Q: Why would the researchers look for transposase genes when the transposase protein itself does not…
A: ARG stands for Antibiotic Resistance Genes. These are genes that provide bacteria with the ability…
Q: E. D. A. B. 11. C. Huntington's disease is a degenerative disease of the nervous system that strikes…
A: Introduction :- Huntington's disease is a genetic disorder that affects the nervous system, causing…
Q: Which environment is most conducive to a child developing a rich vocabulary quickly? formal…
A: Introduction Development is the process of growth and change that occurs over time, resulting in an…
Q: Compare and contrast the pharmalogical effects of cocaine and amphetamines?
A: Pharmacological effects refer to the effects of a drug on the body's physiological and biochemical…
Q: Amgen (Biotech Company) Action Plan and Implementation for their WASTE SYSTEM. Research the impacts…
A: Waste management has become a critical issue in the modern world as businesses strive to become more…
Q: A population of a city reproduces at a rate of 3% per year and has a death rate of 1% per year.…
A: Population estimates are used to study the demographic characteristics of an area, such as age,…
Q: This table lists three hypothetical versions of the spike protein gene in the coronavirus. The B…
A: Coronavirus: Coronavirus (COVID-19) is a highly contagious respiratory illness caused by a virus…
Q: Write a sentence or two defining the essential function or structure where appropriate of the…
A: The cell is made up of various parts that have different functions. Each part serves a specific…
Q: Tube 0.2mM 0.2mM 0.01N distilled Chloro- DPIP DCMU NHẠCH H₂O plasts 2.5ml 0 0 0 1 2* 3 4 5 2.5ml…
A: The term photosynthetic electron transport refers to the method used by phototrophic organisms to…
Q: Make a table of the cranial nerves VI, VII, VIII, IX, X including the general and specific function…
A: Cranial nerves are a group of 12 nerve pairs that originate in the brain and control functions in…
Q: Which of the following statements regarding Antidiuretic Hormone signaling is false? - it involves…
A: Introduction :- ADH is a hormone produced in the hypothalamus and released from the posterior…
Q: Which environment is most conducive to a child developing a rich vocabulary quickly? formal…
A: Learning refers to the process of acquiring new knowledge, skills, behaviors, attitudes, or values…
Q: Monique is a young child who is enthusiastic about animals. One day, she says, "dogs," "cats,"…
A: Overregularization is described as "the application of a principle of regular change to a word that…
Q: Describe how fully formed ribosomes that are made in the nucleolus move out of the nucleus into the…
A: Introduction Ribosomes are molecular machines found in cells that are responsible for translating…
Q: a: a' Answers typed in all of the blanks will be automatically saved. rol al C: b' d: In this DNA…
A: Replication bubble is a structure formed during DNA replication in which the two strands of…
Q: hyperkalemia has a drastic effect on the heart muscle
A: INTRODUCTION Hyperkalemia is a condition in which there is an abnormally high level of potassium in…
Q: Rice is the number one food crop, feeding over 50% of the world's population. Some scientists…
A: Introduction Photosynthesis is the process by which plants, algae, and some bacteria convert light…
Q: Which among the 4? 8!/1!1!6! (12/16) (3/16)^6 (1/16 8!/1!1!6! (9/16) (3/16)( 4/16)^6 1!1!6!/8!…
A: In this discussion, we will explore the method for determining the likelihood of obtaining a mix of…
Q: In the background section the authors wrote “Moreover, seizure levels and neurotransmitter contents…
A: Neurotransmitters are chemical messengers that transmit signals between neurons or between neurons…
Q: A cell is grown on minimal media containing only glyceraldehyde 3-phosphate as a source of carbon…
A: Introduction :- Glyceraldehyde 3-phosphate (G3P) is a three-carbon molecule that is an important…
Q: 10. Living animals, such as dogs, ovulate A. four times a year B. once a year C. twice a year…
A: Introduction : The process of ovulation occurs when the mature egg releases from the ovary and…
Q: Describe each trait Black body, sable body, and Dichaete wings, and the physical characteristics of…
A: Fruit flies with black bodies are characterised by the total blackness of their bodies. *The gene in…
Q: what are the contributing factors with unintentional injuries from vehicular accident?
A: Introduction Injuries refer to any physical damage or harm to the body that is caused by external…
Q: How do cis and trans fats chemical structures help with identifying lipids?
A: Introduction Lipids are a diverse group of organic molecules that are insoluble in water but…
Q: How does a carbon sink work? Can you explain in technical detail all the processes involved and how…
A: Everything that exists depends on carbon. The distribution of carbon throughout the planet's…
Q: GACGATTACACG what is the complimentary RNA strand?
A: Introduction RNA (ribonucleic acid) is a type of nucleic acid that plays a crucial role in protein…
Q: It is well known, and scientifically documented, that yawning is contagious. When we see someone…
A: A hypothesis is a proposed explanation or tentative answer to a research question or problem. It is…
Q: In chickens, comb appearance is controlled be a specific gene that can occur in dominant form (R),…
A: Introduction: Gregor Mendel, a monk who experimented with pea plants in the middle of the 19th…
Q: Questions based on the image 1. a) What was the average total and fecal coliform counts for toilet…
A: The most probable number (MPN) is a statistical method used to estimate the viable numbers of…
Q: As protons (H+) pass through the mitochondria inner membrane… Question 10 options: a)…
A: Mitochondria: Mitochondria are organelles found in eukaryotic cells that are responsible for…
Q: You are a Physician's Assistant in the Emergency Room. A 19-year-old female is admitted in an…
A: The complement system is a part of the innate immune system that helps to fight against invading…
Q: In an epoxidation lab, why is it important to continue stirring vigorously in order to get a good…
A: The addition of oxygen to the carbon-carbon double bond is known as the epoxidation reaction. The…
Q: It has been said that humans are a keystone species. Do you agree or disagree with this statement.…
A: Introduction: A species is a group of organisms that share common physical and genetic traits, can…
Q: Make a presentation using the ecosystem to show the interrelationship of animals and plants. It…
A: An ecosystem is a complex network of living organisms, their physical environment, and the…
Q: Which of the following statements concerning drug delivery system is INCORRECT?* A.Drugs with good…
A: Introduction The term "drug" can refer to any substance that alters the functioning of the body…
Q: You have been hired by a consultancy firm to assess a recent demographic and health survey report of…
A: Introduction Demographic health refers to the study of the relationships between demographic…
Q: Identify agencies and describe the programs offered by the state to reduce the impact with…
A: Injury prevention strategies are critical for a country's inhabitants' health because injuries, both…
Q: Question 2 Highlight the morphological differences between macrophages and neutrophils.
A: Introduction: There are three main types of blood cells: Red blood cells (erythrocytes): These…
Q: vide the individuals (Table above) into two (A and B), based on their blood glucose test 5. Write…
A: Blood glucose level is an important criteria to confirm if a person is lactose tolerant or lactose…
Q: Give typed explanation of both question 1) What is Linkage disequilibrium as applied to HLA…
A: HLA (Human Leukocyte Antigens) antigens are a group of proteins present on the surface of cells in…
Q: Part II. Solving Genetics Problem. Do what is asked. Show your solution. A. Monohybrid Cross 2. Long…
A: Introduction :- Cross in genetics is basically experimental breeding between two organisms or plants…
Q: How does the pathogenic microorganism mycobacterium tuberculosis secretes lipids called mycolic…
A: Introduction Mycobacterium tuberculosis (Mtb) is a pathogenic bacterium that causes tuberculosis…
Q: Based on the previous figure, how is energy converted successively from NADH to protons, and then…
A: Oxidative Phosphorylation: In the metabolic process known as oxidative phosphorylation, also known…
Q: Show a diagram on how carbohydrates, proteins, and fats breakdown in the body for energy
A: Metabolism is essential for life as it provides the energy required for various cellular functions,…
Q: Briefly describe the change in the brown adipose tissue (BAT) mass and the brown adipose tissue…
A: Squirrels are the members, belonging to the family, Sciuridae. It is a family that includes the…
Q: The Generation of Clonal Diversity Is genetically controlled Causes multiples of the same type of…
A: Introduction Clonal diversity is the process by which the immune system generates a large number of…
Q: QUESTION 3 Why is algae more optimal to farm for biofuel than crops? OA. Is easier to farm than…
A: Introduction: A wide variety of aquatic creatures, algae include everything from simple…
Step by step
Solved in 2 steps
- The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt-5’ Answer the following questions: Q1. Which is the coding strand? Which is the template strand? [10%] Top-bottom. Bottom-Top. Both can be used as either coding or template for this gene.The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt What is the length in AA’s of the Sh protein? Assume fMet is NOT CLEAVED [10%] 39 AA 13 AA 12 AA 21 AAThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
- Based on sequences A,B,C. Provide an anticodon sequence that would build this protein. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…Figure 1 is a bacterial gene (1-180). The first base to be transcribed is the base located at position 77. 45 5' TTGGT CTTGG TCGGA TTCCA GAGGA TGAAG TGTTG ACAGC GCATT 3' 3 AACCA GAACC AGCCT AAGGT CTCCT ACTTC ACAAC TGTCG CGTAA 5' 46 5 AATTG ACCTT GCTGT ATTAT AGCCA AGGAC AGATC TACGA GCATG 3' 3 TTAAC TGGAA CGACA TAATA TCGGT TCCTG TCTAG ATGCT CGTAC 5' 91 5 TGCGA ACCGC AAGCA TTCGT TCTCC TAGGC TACTC GATCC CGTAA 3' 3 ACGCT TGGCG TTCGT AACCA AGAGG ATCCG ATGAG CTAGG GCATT 5 77 90 110 135 136 5 TGATG TAGCT GATTC TGTTG AAAGG CTCCT TTTGG AGCCT TTTTT 3 3' ACTAC ATCGA CTAAG ACAAC TTTCC GAGGA AAACC TCGGA AAAAA 5 156 180 Figure 1. Illustrate how termination of transcription occurs in the gene above. (Hint: position from 156 to 180)
- what is the anticodon sequence that would build this protein? AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGUUGUAUUUGGUUUGUGGCGAGCGCUUUUACCAGUUAGAGAAUUACUGATranscribe the following DNA sequence into RNA, and then into amino acids 5’-GTATACTTGTGGGCCAGGGCATTAGCCACACCAGCCACCACTTTCGGATCGGCAGCC-3’ 3’-CATATGAACACCCGGTCCCGTAATCGGTGTGGTCGGTGGTGAAAGCCTAGCCGTCGG-5’What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 1317) Synthesis of the mRNA starts at the boxed A/T base pair indicated by the box and proceeds left to right on the sequence below. Transcribe and translate this bacterial gene. 5'-GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTIGICAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG-3 3'-CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC-5′ 1 -+--at - --+-- 80What’s the resulting amino acid sequence? 3’CAG TTA AGC CTC GGT TAC CAG GAT ACG GGA 5’