Please draw the structure of DNA and label the parts. Thank you very much for your help
Q: Create the complementary DNA strand: AGC-CGA-CCA-TTA Your answer
A: Complementary DNA It is DNA synthesized from a single stranded RNA template in a reaction catalyzed…
Q: the difference between the chemical structures of DNA & RNA and state the said difference in a short…
A: Both the DNA and RNA are made of nucleotides , containing a fivecarbon sugar backbone (pentose) , a…
Q: 1. In your own words define the process of DNA Replication, Transcription, and Translation.
A: DNA Replication In the process of DNA replication, the DNA makes multiple copies of itself. It is a…
Q: DNA Extraction using Tomato DNA Extraction by Mouthwash
A: DNA extraction is a technique for isolating DNA from cell membranes, proteins, and other biological…
Q: Transcribe and Translate the DNA strand: ORIGINAL DNA TAC/ACC/TTG/GCG/ACG/ Strand: RNA strand: Amino…
A: Transcription is the process in which m RNA is synthesized and the translation is the process in…
Q: DNA Fingerprints Cat Kittens IL || ILL || I I
A: DNA fingerprinting is a technique used to compare sequences in genomes using satellite DNAs like…
Q: The following is the sequence on one of a DNA molecule A A T G C C A G T G G T 1. If this strand is…
A: “Since you have posted a question with multiple sub-parts, we will solve first three sub parts for…
Q: Can you help me to explain these dna model
A: DNA( Deoxyribonucleic acid) is a molecule that carries all the information from one generation to…
Q: What did Pauling and Corey discover about DNA?
A: Cell is an elemental unit inside the body in which numerous metabolic activities takes place . It…
Q: Please explain it simply, and don't over-explain. Thanks!
A: DNA is a genetic material that regulate all functions and character of our body. It condensed to…
Q: You are working as a CSI analyst. You collected DNA at a crime scene that is from the suspect but do…
A: If the collected DNA at the crime scene is from the suspect but the amount is not enough to run a…
Q: Why does Valerie's blood from her peripheral, tumor and breast samples all show bands of DNA that…
A: Many risk factors for cancer have been identified, including exposure to certain carcinogens in our…
Q: Lay out the genetics of Nicholas’s case, including where the mutationoccurred, what exact nucleotide…
A: Nicholas was a 2 year-old boy with an extreme case of inflammatory bowel disease and susceptibility…
Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT
A:
Q: 6. Identify the DNA sequence below. Write the DNA sequence in 5' to 3' orientation.
A: The DNA (deoxyribonucleic acid) sequence is the order in which the nucleotide bases are arranged.…
Q: why was glycerol added onto the total dna buffers?
A: The effect on DNA separation of adding glycerol to the running buffer was studied using linear…
Q: The illumina method of sequencing uses a unique type of nucleotide building block. What is the…
A: The illumina sequencing is a DNA sequencing method used to determine single nucleotide bases of a…
Q: Directions: Fill in the matching bases in each table from DNA to DNA, DNA to mRNA and mRNA to…
A: * The central dogma consists of Transcription Translation. * Transcription is the process of…
Q: Create the complementary DNA strand: ACC-GCC-TAG-GCA Your answer
A: Complementary DNA (cDNA) is a copy of DNA from the mRNA molecule produced through a reverse…
Q: EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3'…
A: The DNA is formed of several repeating units of monomers called nucleotides. The adjacent…
Q: Here is a nucleotide sequence: ATGCAAGGTT. Choose the answer that correctly identifies both the type…
A: DNA and RNA are two nucleic acid polymers found in all living cells. Both are made up of nucleotide…
Q: Here is a nucleotide sequence: ATGCAAGGTT. Choose the answer that correctly identifies both the type…
A: Nucleic acids are one of the four main classes of biomolecules synthesized from monomeric units…
Q: Study this picture and tell me two pieces of information about the individual with this DNA.
A: A karyotype is the pictorial representation of chromosomes present in the somatic cell of an…
Q: Create a script about genetic manipulation on animals and plants. All contents of the video must be…
A: Genetic engineering is the manipulation of DNA inside a gene to alter a life form's qualities and…
Q: Write a brief paragraph about what a scientist could do with DNA. Could you please help me with…
A: DNA is the genetic material in most of the organisms including hunan. It is a nucleic acid that…
Q: hy wasn’t James Watson punished by the scientific community once more was learned about how he…
A: Watson and Crick started their work on 1950 -1952 . They proposed three stranded model and…
Q: Select the CORRECT statement. Guanine always pairs with cytosine in DNA. DNA is twisted into a…
A: Introduction DNA is the basic genetic material found in most of the species. DNA stands for…
Q: o not copy from anywhere please does a 50% similarity score for two proteins mean that they're the…
A: All living organisms are made up of polypeptides, which contain one or more long chains of amino…
Q: ntroduction to a report on the extraction of DNA using the technique of salting out method.
A: DNA molecule is the larger molecule that consists of a chain of nucleotides which was organized in…
Q: Please check the pic. Find out where the divisions between fragments are , the number of fragments…
A: An important enzyme is EcoRI, plays an important role in recombinant DNA technology. These enzyme…
Q: (AKS 8a2 DOK 2) Some students in the biology classes at Meadowcreek HS analyzed DNA on a gel. The…
A: DNA fragments are negatively charged, so they move towards the positive electrode. Because all DNA…
Q: The enzyme that removes the RNA primer from the Okazaki fragment is: DNA pol III DNA ligase…
A: Introduction: DNA is the hereditary material that defines every cell. It is found within the nucleus…
Q: 3. Research and discuss where single-stranded DNA are found.
A: Introduction When a DNA molecule only consists of a single strand contrary to the typical two…
Q: Enumerate and define the steps/processes involved in replication.
A: Replication is the process in which two identical copies of DNA molecules are produced from the…
Q: Could you please help me with the following questions? I am struggling tremendously. Thanks so much!…
A: It is the spring with water at temperatures substantially higher than the air temperature of the…
Q: DNA Gene Trait DNA Replication Nitrogen Base Chromosome
A: DNA DNA or Deoxyribonucleic acid is a molecule that contains the instructions, required for the…
Q: Please fill in missing DNA/RNA/Amino Acid sequences.
A: DNA: DNA is the basic unit of life.The information here is stored as a code which is made up of…
Q: Which lane shows the DNA fragment completely digested with Pst n
A: Restriction endonuclease are the enzymes which cleave the DNA at specific sites Various sites are…
Q: Please draw or send me a picture of the structure of DNA and label the parts. Thank you very much.
A: Deoxyribonucleic acid: DNA is a genetic material that is present within the nucleus. It was…
Q: Uzair has two protein sequences, he want to check their similarities what he will do?
A: The purpose of sequence similarity calculations is to build the likelihood for sequence homology and…
Q: Calculate volume for 10 ug of DNA.
A: DNA concentration is estimated by measuring the absorbance of a DNA sample in a buffer solution at…
Q: Please help me to write the complementary strands of the following: 1. A strand of DNA has the base…
A: The double-stranded structure of DNA is formed by matching the complementary base pairing.
Q: Draw the complementary DNA strand for the given: 5'-A-T-C-C-G-A-A-T-T-G-3' Draw the complementary…
A: Let us first understand the one letter codes for the given nucleotides: A is Adenine T is Thymine…
Q: 1. Partner DNA strand 2. the mRNA strand 3. The tRNA 4. the formed amino acids 5. the…
A: Given: 3’ T A C A T G C C G A A T G C C 5’ To find: 1. Partner…
Q: Write out the DNA sequence using the following instructions: This is a double stranded DNA hydrogen…
A: The nucleotides polymers are responsible for determining and regulating the genetic characteristic…
Q: make a flowchart to show how DNA replication happens to identify the different enzymes needed in…
A: DNA is the genetic material in most organisms except some viruses. DNA is present as a right-handed…
Q: DNA REPLICATION/REPAIR PROTEINS
A: DNA stands for deoxyribonucleic acid. DNA replication is a very important process in the life cycle…
Q: Rosalind Franklin was unable to calculate the dimensions of the DNA molecule. True False
A: Rosalind Franklin was born in London, England. She was offered at King's College in London for three…
Step by step
Solved in 2 steps with 1 images
- I need help defining what is DNA Chromatography.View the given linked video to see the detailed structure of the different kinds of DNA. After analyzing make a simple illustration to relate the different kinds of DNA to its function. https://www.youtube.com/watch?v=o_-6JXLYS-kIdentify the largest DNA fragment on the gel. Identify the smallest DNA fragment on the gel.
- Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTTCan you please check my answer and make sure it is correct. Question: How can DNA evidence be used to convict or exonerate a defendant? Why is DNA evidence so powerful? Answer: DNA evidence can be used to perform DNA profiling to determine the genotype of the specific DNA sample. With just a small amount of DNA, PCR can produce billions of copies of that specific segment. The segments that are used are from non-coding regions that contain STR’s or short tandem repeats. These very short DNA sequences are repeated and are specific to individuals because we inherit them from our mother and father. Gel electrophoresis separates the PCR products based on their size and each band is compared to the allele ladder. This process helps to identify the alleles present in the original samples. DNA profiling is performed at many loci to be able to tell the genetic difference between different individuals with a lot of certainty. The DNA from the different suspects is compared to the allele…Rosalind Franklin was unable to calculate the dimensions of the DNA molecule. True False
- Create the complementary DNA strand: GCG-CAT-TAC-ATG Your answerCreate a script about genetic manipulation on animals and plants. All contents of the video must be original. Thank you, it's for my project.I selected nucleus, but only received half credit. I'm not sure what else could be considered. Thank you for your help.
- Could you please help me with the following questions? I am struggling tremendously. Thanks so much! Some organisms can live in hot springs. What does this imply about their DNA?Why were you able to see the DNA after adding the ethanol?A health provider contacts you regarding a specific patient. They ask you to sequence this patient’s DNA and sends you her blood sample. You split the patient’s blood sample into three equal parts. With each part, you perform three different protocols of DNA extraction and purification. You analyze the resulting DNA using the nanodrop. Protocol A260/280 ng/ul DNA Total volume (ul) 1 2.02 50 60 2 1.45 156 200 3 0.30 300 120 d)Halfway through the electrophoresis of your gel you realized that rather than using a buffer to make up your gel, you actually used distilled water. Do you think this mistake would alter the outcome of your gel electrophoresis? Explain. e) If you added your DNA to a well in a gel without first mixing it with gel loading solution, would this impact the final results? Explain. f) Only after the run you realize that you forgot to add ethidium bromide to the gel. What will happen to your sample? What could you do to the gel after the run?
