Please explain DNA Sequencing more clearly for me please there's a picture of the decription and also please comment on each line if possible on the code below to for me to have an understanding of what each line is doing. It is in C++.#include <iostream>#include <string>#include <vector>#include <set>using namespace std;set<string> longestCommonSubstring(const string& a, const string& b) { int maxLen = 0; vector<vector<int> > longestSuffix(a.size(), vector<int>(b.size())); set<string> result; for(int i = 0; i < a.size(); ++i) { for(int j = 0; j < b.size(); ++j) { if (a[i] == b[j]) { int &current = longestSuffix[i][j]; current = i == 0 || j == 0 ? 1 : longestSuffix[i - 1][j - 1] + 1; int from = i - current + 1; if (current > maxLen) { result.clear(); result.insert(a.substr(from, current)); maxLen = current; } else if (current == maxLen) { result.insert(a.substr(from, current)); } } } } return result;}int main() { string a, b; bool first = true; while(cin >> a >> b) { if (!first) cout << '\n'; else first = false; set<string> result = longestCommonSubstring(a, b); if (result.empty()) cout << "No common sequence."<<endl; else { for(set<string>::const_iterator it = result.begin(); it != result.end(); ++it) cout << *it << '\n'; } }} DNA SequencingDescriptionA DNA molecule consists of two strands that wrap around each other to resemble a twisted ladder whose sides, made of sugar and phosphate molecules, are connected by rungs of nitrogen-containing chemicals called bases. Each strand is linear arrangement of repeating similar units called nucleotides, which are each composed of one sugar, one phosphate, and a nitrogenous base. Four different bases are present in DNA: adenine (A), thymine (T), cytosine (C), and guanine (G). The particular order of the bases arranged along the sugar-phosphate backbone is called the DNA sequence;the sequence specifies the exact genetic instructions required to create a particular organism with its own unique traits.Geneticists often compare DNA strands and are interested in finding the longest common base sequence in the two strands. Note that these strands can be represented as strings consisting of the letters a, t,c and g.So, the longest common sequence in the two strands atgc and tga is tg .It is entirely possible that two different common sequences exist that are the same length and are the longest possible common sequences. For example in the strands atgs and gctg, the longest common sequences are gc and tgWrite a program that accepts as input two strings representing DNA strands, and print as output the longest common sequence(s) in lexicographical order.InputThe input file contains several test cases with a blank line between two consecutive.The string are at most 300 characters-long.OutputFor each test case, print all the longest common sequences, one per line, in lexicographical order.If there isn't any common sequence between the two strings, just print: 'No common sequence.'Print a blank line between the output of consecutive datasets.Sample Input 1Sample Output 1atgctgtgagcatgctggctg

DNA sequencing here involves finding the longest common sequence from the given 2 strands. For…

Please explain DNA Sequencing more clearly for me please there's a picture of the decription and also please comment on each line if possible on the code below to for me to have an understanding of what each line is doing. It is in C++. #include #include #include #include using namespace std; set longestCommonSubstring(const string& a, const string& b) { int maxLen = 0; vector > longestSuffix(a.size(), vector(b.size())); set result; for(int i = 0; i < a.size(); ++i) { for(int j = 0; j < b.size(); ++j) { if (a[i] == b[j]) { int ¤t = longestSuffix[i][j]; current = i == 0 || j == 0 ? 1 : longestSuffix[i - 1][j - 1] + 1; int from = i - current + 1; if (current > maxLen) { result.clear(); result.insert(a.substr(from, current)); maxLen = current; } else if (current == maxLen) { result.insert(a.substr(from, current)); } } } } return result; } int main() { string a, b; bool first = true; while(cin >> a >> b) { if (!first) cout << '\n'; else first = false; set result = longestCommonSubstring(a, b); if (result.empty()) cout << "No common sequence."<::const_iterator it = result.begin(); it != result.end(); ++it) cout << *it << '\n'; } } }

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Related questions

Question

Please explain DNA Sequencing more clearly for me please there's a picture of the decription and also please comment on each line if possible on the code below to for me to have an understanding of what each line is doing. It is in C++.

#include <iostream>
#include <string>
#include <vector>
#include <set>

using namespace std;

set<string> longestCommonSubstring(const string& a,
const string& b) {
int maxLen = 0;

vector<vector<int> > longestSuffix(a.size(), vector<int>(b.size()));
set<string> result;

for(int i = 0; i < a.size(); ++i) {
for(int j = 0; j < b.size(); ++j) {
if (a[i] == b[j]) {
int &current = longestSuffix[i][j];
current = i == 0 || j == 0 ? 1 :
longestSuffix[i - 1][j - 1] + 1;

int from = i - current + 1;

if (current > maxLen) {
result.clear();
result.insert(a.substr(from, current));
maxLen = current;
} else if (current == maxLen) {
result.insert(a.substr(from, current));
}
}
}
}

return result;
}

int main() {
string a, b;
bool first = true;

while(cin >> a >> b) {
if (!first)
cout << '\n';
else
first = false;

set<string> result = longestCommonSubstring(a, b);

if (result.empty())
cout << "No common sequence."<<endl;
else {
for(set<string>::const_iterator it = result.begin();
it != result.end(); ++it)
cout << *it << '\n';
}
}
}

DNA Sequencing
Description
A DNA molecule consists of two strands that wrap around each other to resemble a twisted ladder whose sides, made of sugar and phosphate molecules, are connected by rungs of nitrogen-containing chemi
cals called bases. Each strand is linear arrangement of repeating similar units called nucleotides, which are each composed of one sugar, one phosphate, and a nitrogenous base. Four different bases are pres
ent in DNA: adenine (A), thymine (T), cytosine (C), and guanine (G). The particular order of the bases arranged along the sugar-phosphate backbone is called the DNA sequence;the sequence specifies the e
xact genetic instructions required to create a particular organism with its own unique traits.
Geneticists often compare DNA strands and are interested in finding the longest common base sequence in the two strands. Note that these strands can be represented as strings consisting of the letters a, t,
c and g.So, the longest common sequence in the two strands atgc and tga is tg .It is entirely possible that two different common sequences exist that are the same length and are the longest possible comm
on sequences. For example in the strands atgs and gctg, the longest common sequences are gc and tg
Write a program that accepts as input two strings representing DNA strands, and print as output the longest common sequence(s) in lexicographical order.
Input
The input file contains several test cases with a blank line between two consecutive.
The string are at most 300 characters-long.
Output
For each test case, print all the longest common sequences, one per line, in lexicographical order.
If there isn't any common sequence between the two strings, just print: 'No common sequence.'
Print a blank line between the output of consecutive datasets.
Sample Input 1
Sample Output 1
atgc
tg
tga
gc
atgc
tg
gctg

Expert Solution

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.