Please help me explain this on my report on cell dogma
Q: 6 please label all the distinct parts of the cheek cell IN THE PHOTO ONLY PLEASE DO NOT USE OTHER…
A: Eukaryotic cel are advanced type of cell present in higher Organism that exhibit nucleus and…
Q: Identify the dermatophytic fungal infections affecting the following sites: Scalp Groin Hands
A: The homogenous clade of keratinophilic filamentous fungi is found to be closely related to the group…
Q: Subcutaneous
A: Drugs in the form of fluid or liquid are generally given through injections. These injections are…
Q: color blindness in
A: Honey is an expensive and highly beneficial for human body. This is created by honey bees by…
Q: Rheumatoid Arthritis: Adverse drug reactions Medication Initial Maintenance Symptoms to inquire…
A: Rheumatoid arthritis, an auto immune disorder that mainly affects the joints and causes an…
Q: Fill in the Punnett Square below. The first box is done for you. b bb B.
A: Sir Gregor Mendel was a priest and a teacher who did the famous hybridization experiment on garden…
Q: 1- Use document 1 to label the 2 photos of human skin sections obtained at different magnifications…
A: Skin: It's an outer covering of the body which protects us from heat, injury, and infection. The…
Q: Xerophthalmia is caused due to the deficiency of vitamin ________.
A: Vitamins are natural substances that people enjoy in small amounts. The majority of vitamins must be…
Q: Identify the highlighted structure
A: Cells are the structural and functional unit of life. Many cells combine to form tissues and many…
Q: tatus: * Question Completion Which letter in the figure represents phlanges? O A. A O B. B OC.C O…
A: The letter D depicting the body part is the phalanges. Phalanges are the bones that constitute the…
Q: Application of differential staining technique.
A: Differential staining is a staining technique that employs the application of several different…
Q: Please label this correctly
A: Shark are group of elasmobranch fish characterized by cartilaginous skeleton, five to seven gill…
Q: common household item that looks like the ovary and testes
A: Figs seeds hang in twos when they grow looks as two testis in scrotum.
Q: labelled X
A: The element that is present in 'X' part is "Adenine".
Q: Flow chart of the Central Dogma, include four deviation of the Central Dogma.
A: DNA is the genetic material in living organisms.
Q: Help the label name
A: Thoracic vertebra(12 vertebrae (T1 to T12)) Vertebrae of the thoracic region have limited movement…
Q: 14 "16 18 24
A: Human nervous system is divided into three parts- 1. CNS- Central Nervous System- It consists of…
Q: 1pt A test cross
A: Answer: The genotype of the purple-flowered plant is PP. Since white flowers are recessive, the only…
Q: What is a carcinoma in situ (CIS)? Edit View Insert Format Tools Table 12pt v Paragraph v d to…
A: Carcinoma in situ is a group of abnormal cells which have not spread beyond the place of their…
Q: please label with the word bank.
A: Metridium are known as plumose anemones that are found in the Atlantic and north Pacific oceans…
Q: 1. Stipulative definition of microscope. 2. Stipulative definition of bubonic plague.
A: -A Stipulative definition is a kind of definition in which new terms or currently used or currently…
Q: Chemiosmosis
A:
Q: Please label accordingly.
A: a. "All point mutations in DNA ultimately result in an altered amino acid sequence in the resulting…
Q: Why is it important to use the correct/proper dissecting tools?
A: The Use of correct / proper dissecting tools is important for a particular dssecting procedure…
Q: The three micrographs on the right (A, B, C) are higher magnification of areas (labeled A, B, C,…
A: Gorham's disease It is a rare condition characterized by disappearance of bone.
Q: Write a Short note on Cystic fibrosis or write a short note on overview of cystic fibrosis? Please…
A: CF - cystic fibrosis is an inherited disorder. It causes the severe damages to the digestive…
Q: Label all labels
A: The integumentary system consists of the skin and accessory structures. Hair is one of the accessory…
Q: Write down about the skin test for tuberculosis? Please answer at your own words.
A: Skin is very sensitive to the foreign antigen and when antibody is present in the body against that…
Q: 2 please label all the distinct parts of the cheek cell IN THE PHOTO ONLY PLEASE DO NOT USE OTHER…
A: A basic and structural unit of life is defined as cell. All living organisms are made up of cells.…
Q: Please help me explain this on my report on cell dogma
A:
Q: Match items in Column A with most related ones in B. Write the letters on the space provided.
A: Electrophoresis It refers to tbe technique through DNA, RNA, and proteins are separated in the…
Q: An allergy to pollen: on
A: Pollen is a fine powdery substance that is typically yellow in color and will consist of microscopic…
Q: Steps or measures in order to see a bacteria under a microscope clearly
A: Bacteria are generally small unicellular prokaryotic organisms found in every environmental…
Q: Label the figure
A: BASIC INFORMATION HUMAN BODY The body of the human beings is made up of different types of cells,…
Q: D. Picture A [Choose ] Picture B [Choose ] Picture C [Choose]
A: Mitosis is a cell cycle step in which duplicated chromosomes are separated into two new nuclei. When…
Q: pox, then add the text to the box and click Save'and Close.) edu gear (100
A: Thank you for the question Answer = A cell is a cytoplasmic mass that is enclosed by a cell…
Q: 38.Label the drawing:
A: Angiosperm plants have different parts. These are root, stem, leaves, flowers, fruits, and seeds.…
Q: Use the 4 images to complete page 100 correctly
A: Scyphozoa, the polypoid larval stage which develops from a planula larva.
Q: can help me help to understand this slides by labelling them and describe them
A: Areolar connective tissue is the kind of tissue that covers and links the body's many organs. The…
Q: A B D F
A: Anatomy The dorsal column-medial lemniscus mechanism (DCML) is a nervous system sensory path. It…
Q: this is a Skin
A: The skin is composed of two main layers: the epidermis, made of closely packed epithelial cells, and…
Q: ould you please label and tell me what they are? (animal or plant cell)
A: All organisms in life are composed of at least one or more cells. Cells are the basic units of life.…
Q: 5.
A: It is a median section of the brain.
Q: Identify the dermatophytic fungal infections affecting the following sites: Bearded Area Nails…
A: Skin diseases or skin disorders are a broad range of conditions affecting the skin, and include…
Slide 3
Please help me explain this on my report on cell dogma
Step by step
Solved in 2 steps with 3 images
- Eukaryotic RNAs, such as tRNA and rRNA use different RNA Polymerases. True FalseThe dUTPase enzyme is used by the African swine fever virus to repair its own DNA, as the cells the virus infects in swine do not express the dUTPase protein. Which of the following is a reasonable explanation for the role of the dUTPase in the virus lifecycle? Explain your choice in 25 words or less. The dUTPase is necessary to remove dUTP from the viral genome, as uracil should not be present in DNA The dUTPase is necessary to remove dUTP from the viral genome, as uridine cannot correctly base pair with adenine-containing bases The dUTPase is necessary to remove dUTP from the viral genome, as uridine has the wrong sugar component for building DNA More than one of the above answers is correct None of the above answers is correctWhich biological system contains a protein nucleocapsid surrounding 2 antiparallel polynucleotide strands (held together by hydrogen bonds), with deoxyribose sugars, but no ribose sugars? a single-stranded RNA viroid (like avocado sun blotch viroid) a double-stranded RNA virus (like the reovirus family) a single-stranded DNA virus (like fX174 virus of E. coli) a double-stranded DNA virus (like the smallpox virus) a single-stranded RNA virus (like tobacco mosaic virus)
- The most likely and immediate affect of the deletion of the Shine-Dalgarno sequence would be: Group of answer choices initiation of replication will not take place 50S subunit cannot form the initiation complex ribosomes will be unable to bind to mRNA mRNA will degrade more rapidlyIt asks to categorize the possible answers to a component of eukrayotic RNA, eukrayotic DNA or both:The name for the kind of point mutation/base substitution when a codon changes from CCC (which codes for proline) to CGC (which codes for arginine) is mutation. 2nd base in codon U CAG Cys Cys STOP STOP Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly Phe U Phe Leu Leu Ser Ser Ser Ser Tyr Tyr STOP Leu Leu Leu Leu Pro Pro Pro Pro His His Gln Gln C Asn Asn lle lle lle Met Thr Thr Thr Thr Ala Ala Ala Ala Lys Lys Asp Asp Glu Glu Val Val Val Val 3rd base in codon DCAGUCAGUCAGUCAG 1st base in codon
- For the mutations described below, categorize them in each of the following ways: [transition, transversion, insertion, or deletion]; [synonymous, missense, nonsense, frameshift, or regulatory]; [beneficial, deleterious, or neutral] A mutation in the SARS-CoV2 virus changes a codon in the gene encoding the spike protein from AAG to AAC. This mutation increases the ability of the virus to spread from person to person. Becker muscular dystrophy results in progressive wasting of skeletal and heart muscle tissue. A patient is found to have a mutation in the dystrophin gene (DMD) in the first nucleotide of intron 25. Normally, a G is in this position, but the patient has an A. Fur color in house cats is affected by several genes that encode pigment-producing enzymes. One such gene is found to have an additional C after position 45 in orange cats but not in black cats.Which of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5'-3'. OA. AAGAUCGUCGAUCGGUCAUG OB. AAGATCGTCGATCGG TCATG OC. GTACTGGC TAGCTGC TAGAA OD. GUACUGGCUAGCUGCUAGAAThe nucleotide is ✓ adenine adenosine adenosine monophosphate cytidine prion
- RNA polymerase is associated with which of the following processesDescribe in general terms the strategy used by single-stranded (ss) DNA viruses to synthesize their nucleic acids and proteinsA protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain? 5'-ATGTCGACAGCCTAA-3' First Second Letter Third Letter U A G Letter phenylalanine serine tyrosine cysteine U phenylalanine serine tyrosine cysteine U leucine serine stop stop A tryptophan arginine arginine leucine serine stop leucine proline histidine U leucine proline histidine leucine proline glutamine arginine A leucine proline glutamine arginine G isoleucine threonine asparagine serine U isoleucine threonine asparagine serine A isoleucine threonine lysine arginine A methionine threonine lysine arginine G valine alanine aspartate glycine U valine alanine aspartate glycine G valine alanine glutamate glycine A valine alanine glutamate glycine G O Met-lle-Thr-Ala-STOP O Met-Ser-Thr-Ala-STOP Met-Ser-Trp-Arg-STOP Met-Tyr-Thr-Arg-STOP