Question 4: Explain how a deletion mutation leading to a modification of the 3' untranslated region (UTR) on the CACNA1S mRNA could lead to hypokalemic periodic paralysis without changing the structure of the polypeptide formed? (Note this is not the known cause of hypoKPP, but it makes a good question)
Q: The host protiens specific for individual virus classes are: a. Docking proteins b. DNA…
A: The correct answer is:c. Proteases
Q: A blood-alcohol content (BAC) level of milliliters of blood is considered legally intoxicated. O .04…
A: For legal or medical reasons, blood alcohol content—also known as blood alcohol concentration or…
Q: Which of the following is a characteristic of steroid hormones? A. Activation of adenylate cyclase…
A: The question is asking us to identify a characteristic that is specific to steroid hormones. Steroid…
Q: Case Study: Sarah's Immune Challenge Background: Sarah is a 35-year-old nurse who recently started…
A: In the depicted graph, the teal line represents the initial immune response known as the innate…
Q: 44- Which organelle is responsible for the storage, modification, and packaging of proteins for…
A: The fundamental anatomical and functional components of living things are their cells. They are…
Q: Flooding causes an accumulation of high levels of ethylene in plant roots. True or false
A: Flooding causes severe environmental stress for plants, especially those that thrive in low-lying or…
Q: Moscovy ducks meat production characteristics
A: I hope you find this helpful, incase of any clarification i will be happy to clarify 1 The flesh…
Q: Hemophilia is a recessive sex-linked disorder (Xh). A man with hemophilia and a female carrier are…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: DNA damage by uv light creates pyrimidine dimers between adjacent pyrimidines on the same strand.…
A: DNA damage is defined as a change in the basic structure of DNA that is not itself replicated when…
Q: using ________ will
A: (1 )Conjugation:ExplanationConjugation is a process in bacteria where genetic material is…
Q: The pedigree below represents the inheritance of a rare genetic disorder (members joining the…
A: The answer is written in explanation box below:Explanation:…
Q: You have 2 mL of bacterial culture. How would you make a 10^-2 dilution using the entire culture…
A: The objective of this question is to understand how to make a 10^-2 dilution of a bacterial culture…
Q: How can one obtain 2,000X magnification with a 100X objective?
A: Magnification is defined as an action of magnifying something. It refers to enlarging the apparent…
Q: Look up this information about the mineral fluorine: 1.Sources of this mineral2. Functions of the…
A: The objective of the question is to gather comprehensive information about the mineral fluorine, its…
Q: Of the five types of electron carriers, which has the smallest molecular mass? Which has the…
A: The electron transport chain is made up of four protein complexes that combine redox processes to…
Q: There are two genetic loci determiningthe mating type, locus A with 288 alleles and locus B with 81…
A: The objective of the question is to understand the mating compatibility of Schizophyllum commune…
Q: 18) What tissue samples the above slides were taken from?19) What is the name of the parasite…
A: The provided histological slides depict tissue samples from patients infected with two different…
Q: What are the properties of genetic material? Must encode information. The information must be used…
A: Genetic material occurs in the form of DNA which is deoxyribonucleic acid. DNA is made up of…
Q: What is true of an X-linked gene but not of a Y-linked gene? O It does not segregate like other…
A: There are two types of chromosomes in humans - The autosomes (22 pairs) and the sex chromosomes (1…
Q: Which medium is well-indicated to amplify a small population of bacteria mixed with much larger…
A: The goal is to find a suitable medium for amplifying a small population of bacteria together with…
Q: Label each of the points on the diagram below depicting replication in prokaryotes. Indicate the…
A: DNA replication in prokaryotes is a principal process for cellular division and development. It is…
Q: X D A B C 11:32 E MT Sp 24 H K 56% 50 5 Using the diagram above, answer questions 26-35: 26) To…
A: 26) To zero in on an example with the examining power objective focal point, you would utilize the…
Q: The inability to recruit Cdc6 to the origin recognition complex results in a lower concentration of…
A: The initiation of DNA replication is a highly regulated process, involving key proteins and…
Q: IUCN Threat Category griculture & aquaculture esidential & commercial development mergy production &…
A: The chart shows number of species present in threatened category in US affected by different…
Q: Muscovy Ducks Morphological Description
A: Answer -Muscovy Ducks They are large, heavy-bodied ducks, having long necks that can appear like…
Q: If a bacterial chromosome were inserted into a eukaryotic cell, would it be stable? Would it…
A: Challenges of Inserting Bacterial Chromosome into Eukaryotic CellsNo, a bacterial chromosome…
Q: what are the best examples of healthcare adiminitration issues?
A: The objective of the question is to identify and explain some of the most significant issues faced…
Q: 2. After being bitten by a poisonous snake, a patient will receive a mixture of antibodies against…
A: When an individual is bitten by a deadly snake, the poison can deliver dangerous physiological…
Q: The video discuss some of the factors that allowed lionfish to expand throughout the Atlantic…
A: The factors mentioned for the rapid expansion of lionfish in the Atlantic region include:B. The…
Q: Which of the following is most likely the result of drift? OA beneficial allele increasing in…
A: Genetic drift is a key concept in evolutionary biology that describes the random changes in allele…
Q: Draw the mechansim succinyl co-a synthease with its structure and label it appropriate
A: Succinyl-CoA synthetase, plays an essential part in cellular metabolism, especially inside the…
Q: The amount of chlorophyll a (M, 892) in a spinach leaf is about 20 µg/cm² of leaf. In midday…
A: Chlorophyll is a green pigment found in the chloroplasts of plants and other photosynthetic…
Q: Which of the following brain regions is a limbic region that receives nociceptive input from the…
A: The objective of the question is to identify the brain region that is part of the limbic system and…
Q: Which of these is NOT an assumption made by HWE? Group of answer choices Mating is random No…
A: The law of Hardy-Weinberg equilibrium took its name from G.H. Hardy and Wilhelm Weinberg.According…
Q: A 10-year-old boy undergoes an appendectomy. Granulation tissue develops normally at the incision…
A: The question is asking about the protein responsible for the degradation of collagen in the…
Q: A male Drosophila with wild-type phenotype is discovered to have only seven chromosomes, whereas…
A: The objective of this question is to determine the genotypes, phenotypes, and total number of…
Q: In Hereford cattle, the phenotypic expression of coat pattern called line-back (a white line down…
A: 1. Allele frequency for the line-back trait:We can solve this problem using the Hardy-Weinberg…
Q: Rupert and Leona's bunnies liked to play with their food. One night while playing with their corn,…
A: This solution is related to the transmission of characteristics from parents to offspring according…
Q: There are different methods to deal with microorganisms’ growth. Whar are the various physical…
A: Microorganisms' growth can be managed through physical, chemical, and biological methods.Chemical…
Q: A snake species that has migrated from the mainland to a small island eats banana slugs instead of…
A: Constitution in the form of DNA of an organism is called its genotype and expressed character or…
Q: are habitats and ecosystems influence by the area surrounding them?
A: The objective of the question is to understand if and how the surrounding area influences habitats…
Q: How do elephants communicate and how do they interpret the different high and low frequency sounds?
A: The objective of this question is to understand the communication methods of elephants and how they…
Q: he following: (conventional methods only: culture, through a byproduct and/or immune response)…
A: Identification of infectious diseases is necessary for effective treatment and management.…
Q: What is the allele frequency of webbed fingers in the population
A: Denote the allele frequency of webbed fingers in the population:p as the frequency of the dominant…
Q: Depending on the size and complexity of the molecule, small chemical alterations can impart…
A: I hope this helps you! Thank you! If you have any doubt comment down i will surely be there to help…
Q: Based on base substitution rates, which of the following is likely to be true? P(A/G) + P(A/T)…
A: In molecular biology, base substitution mutations are classified into two main…
Q: What drug produces myosis, which will contract the pupil of the eye?
A: Myosis refers to the extensive constriction of the pupil of the eye. It is the part of the eye that…
Q: Explain the difference between generalized and specialized characteristics. What are examples of…
A: Generalized and specialized characteristics refer to two contrasting strategies that organisms…
Q: Answer this information about the mineral Nickel 1. Sources of this mineral2. Functions of the…
A: The objective of the question is to provide comprehensive information about the mineral Nickel,…
Q: 4. In fruit flies, opaque wing color is due to an X-linked dominant version of a gene. A female with…
A: The exchange of genetic material between two non sister chromatids is called crossing over..Crossing…
Trending now
This is a popular solution!
Step by step
Solved in 1 steps
- Once the chains of peptides that make up lysyl-tRNA synthetase protein are synthesized in ribosomes, lysyl-tRNA synthetase needs to have the proper active site in order to perform its function, explain the process of protein folding necessary to have a proper 3-D structure, include effect of thermodynamics and different states in folding, including what happen when there are prolines that form peptide bonds with other amino acids, and any disulfide bridgesMany blood clotting proteins undergo a post-translational modification in which specific glutamic acid residues (Glu) in the protein are converted to gamma-carboxyglutamic acid residues (Gla). See reaction scheme below. An example is the blood clotting protein Factor IX, which has 12 Glu in its N-terminus converted to Gla. This modification gives Factor IX the ability to bind calcium and phospholipid membranes. Bacteria do not have the enzyme required to convert Glu to Gla and therefore Factor IX proteins expressed in bacteria would not have the proper modifications. How might you engineer the translational apparatus of a bacterial cell line so that it produces Factor IX with Gla in the appropriate positions. How would you ensure that only the 12 Glu in Factor IX that are normally converted to Gla and not just all Glu (Limit 5-6 senetnces)?One single polypeptide chain (120 amino acid residues) is produced for protein A in prokaryotic cell. N-terminal amino acid is alanine in the chain of this protein. How many moles of ATP and GTP will be in use for this polypeptide chain synthesis? What post-translational modifications may be for this protein?
- Question 28 Introns Protein-coding sequences that need to be excised B Non-coding regions that need to be excised Protein-coding sequences that form part of the mature MRNA Non-coding regions that form part of the mature MRNA Question 29 Anomers are A Either the open chain structure or the cyclic structure, established through mutarotation B) Either L or D Cyclic monosaccharides that differ only in the positions of substituents at carbon (alpha or beta) The fifteen other stereoisomers of glucose Question 30 The nuclear lamina A is the site of ribosomal RNA (FRNA) synthesis maintains the shape of the nucleus encloses the nucleus to separate it from the cytoplasm D) regulates the entry and exit of molecules from the nucleusDiscuss the key factors & mechanisms during co-translational translocation by which START TRANSFER and STOP TRANSFER sequences help the protein generate appropriate number of transmembrane regions with N or C terminal on the designated side of the plasma membrane.(NO PLAGIARISM)What are the functional consequences of this deletion for lilP mRNA transcription and translation? (100 words max.)
- A poison added to an in vitro translation mixture containing mRNA molecules with the sequence 5'- AUGAAAAAAAAAAAAUAA-3' has the following effect: the only product made is a Met-Lys dipeptide that remains attached to the ribosome. What is the most likely way in which the poison acts to inhibit protein synthesis? It mimics a methionine tRNA. O It inhibits stop proteins from entering the ribosome O It inhibits movement of translocation so it can't empty the P-site O It inhibits the P site from accepting a tRNA to begin withMany clinically relevant mitochondrial diseases are caused by mutations in mitochondrial genes affecting tRNAs. For example, one form of MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes) is caused by a point mutation in the gene encoding the mitochondrial tRNA whose anticodon recognizes the codons 5' UUA and 5' UUG. The mutation makes the aminoacylation of this tRNA inefficient. a. The rate of synthesis of most mitochondrial proteins is either unaffected or slightly decreased in MELAS cells, but one mitochondrial protein called NAD6 is synthesized at only 10% of the normal rate. How is it possible that the translation of this single mitochondrial protein might be affected specifically?Which statements are true? Explain why or why not.1 The consequences of errors in transcription areless severe than those of errors in DNA replication.2 Since introns are largely genetic “junk,” they do nothave to be removed precisely from the primary transcriptduring RNA splicing.3 Wobble pairing occurs between the first positionin the codon and the third position in the anticodon.4 During protein synthesis, the thermodynamics ofbase-pairing between tRNAs and mRNAs sets the upperlimit for the accuracy with which protein molecules aremade.5 Protein enzymes are thought to greatly outnum-ber ribozymes in modern cells because they can catalyzea much greater variety of reactions and all of them havefaster rates than any ribozyme.
- Briefly discuss (referring to the images provided) why mutant 2 fails to produce functional protein. Note that none of the mRNA transcribed from this gene is of the expected size; some of the mRNA molecules produced are 223 nucleotides shorter than expected, whilst others are 47 nucleotides longer than expected.Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3Answer codon usage based on this description: You have isolated a new eukaryotic microorganism and want to determine the genetic code of its mitochondria. Here are the amino acids encoded after translation of two synthetic mRNAs using mitochondrial extracts from your eukaryote- in this experiment translation can start at any sequence position: RNA: Protein: Tyr-Met-Tyr-Met-Tyr-Met---- UAUAUAUAUAUAUAU--- UAAUAAUAAUAAUAA--- Asn-Asn-Asn-Asn-Asn---- Met-Met-Met-Met-Met---- Based on the results shown here, what can you conclude about the codons in this eukaryote? A. B. C. D. O A O C OD OB AUA Tyr Met Tyr Met UAU Met Tyr Met Tyr AAU Met Trp Asn UAA Asn Asn Asn Asn, STOP or Met Asn, STOP or Met