Review translation. Match the term and its description. Each term can only be used once. This site holds the tRNA that carries the growing polypeptide chain Choose) This site holds the tRNA that carries the next amino acid to be |Choose added to the chain This site is the exit site. where discharged tRNAs leave the |Choose ribosome Initiation, elongation and termination | Choose | > > > >

Review translation. Match the term and its description. Each term can only be used once. This site holds the tRNA that carries the growing polypeptide chain Choose) This site holds the tRNA that carries the next amino acid to be |Choose added to the chain This site is the exit site. where discharged tRNAs leave the |Choose ribosome Initiation, elongation and termination | Choose | > > > >

Name: Question 8Review translation. Match the term and its description. Eac
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Question 8Review translation. Match the term and its description. Each term can only be used once.This site holds the tRNA that carries the growing polypeptide chain| Choose )This site holds the tRNA that carries the next amino acid to be| Choose Ja

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 7P

See similar textbooks

Similar questions

RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA. This strand contains both a gene and its promoter region. Circle the promoter region in blue, draw a yellow box around the TATA box, draw a green box around the start codon, and draw a red box around the stop codon: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now imagine this gene has been transcribed into RNA. What would that RNA strand look like? Before the above RNA strand can be translated, a few modifications must first take place (in eukaryotes). What are they? 1) 2) 3) Using a codon chart of your choice (one can be found here, or here) translate the above RNA transcript (assume no splicing took place). Write the three letter abbreviations for the amino acids in the image below: Now imagine that a mutation took place in the original strand of DNA (marked in red) TATATATATTACGTTGCATACCCTCAACGGTCGAAACTGCATG…
Question 7 Review translation. Match the term and its description. Each term can only be used once. transfer amino acids to the growing polypeptide in a ribosome |Choose | these base-pairs of a ERNA with a complementary codon on MRNA [ Choose J The two ribosomal subunits (large and small) are made of proteins | Choose | and this RNA called >
Multiple choice A. The role of tRNA in translation is to be translated by a ribosome. incorporate into a polypeptide chain. attach amino acids to a polypeptide chain. carry amino acids to the ribosome. Multiple choice B. Translation continues until the ribosome falls off the end of the RNA. the ribosome encounters a transcriptional termination site. the ribosome encounters a stop codon. the ribosome falls off the DNA.
AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene? (Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.) Submit Answer Retry Entire Group No more group attempts remain
TATA box is located . Question 11 options: upstream from the initiation site downstream from the initiation site within intron sequence within exon sequence
Translation. Write the anti-codon sequence of the MRNA transcript. Translate the MRNA transcript into peptide sequence using both the 3 letter abbreviation and 1 letter abbreviation. ANTI-CODON 3' 5' SEQUENCE AMINO ACID N- C- SEQUENCE (3 letter terminus Abbreviation) Terminus AMINO ACID N- C- SEQUENCE (1 letter terminus Abbreviation) Terminus
Question:- 1. Transcribe and translate the given region of DNA, note that the promoter region is to the right of the sequence, and translation must start from the start codon. Include 3' and 5' for RNA transcript and N- and C- terminus in your final peptide sequence. Use the 1-letter form of amino acids when writing the sequence of polypeptide 5' CCCCAGCGTAAGTTTATGGTTACTCATGAA 3' 3' GGGGTCGCATTCAAATACCAATGAGTACTT 5'
Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
Question : The peptide bond : (Indicate the right answer) : A- Is a hydrophobic bond. B- Is formed by condensation between the -NH2 function of the first amino acid (AA N° 1) and the -COOH function of the second amino acid (AA N° 2). C- Is generated by the ribosome during the process of transcription. D- Is an amino function. E- All possibilities given above are wrong.
TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.The 2 subunits of DNA PoI II are called clamp loader and sliding clamps. 2. In eukaryotes, replication and transcription occur in the nucleus, while translation occurs in the cytoplasm.
Typed explanation only Codons in mRNA molecule and their corresponding amino acids UUU Phenylalanine UAU tyrosine UUA leucine UAA nonsense GCA alanine AAU asparagine AAG lysine UGC cysteine GUU valine UCG, UCU serine Refer to Table 8.2. If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Group of answer choices 5' TGTGCTTTCTTA 3' 3' AGACGTTTCAAT 5' 3' UGUGCAAAGUUA 5' 5' AGAGCTTTGAAT 3' 3' TCTCGTTTGTTA 5'
An extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.