с" CH2 CH2 "НaN H с. CH С" CH Нзс CHз ZI о-о If you were to replace the second amino acid residue with a similar amino acid in order to maintain function, which one would be best suited? Give the 3-letter abbreviation.
Q: Draw the zwitterion for the amino acid backbone of: glycine alanine proline
A: Amino acids are the subunits for the synthesis of proteins. They are formed of a carboxylic acid…
Q: Why is it no longer considered necessary to determine the Nterminal amino acid of a protein as a…
A: N-terminal amino acid : The N-terminal is the start of a protein or polypeptide referring to the…
Q: Amino Acid: Asn-Met-Ser-Ile-Phe-Arg-Cys-Tyr-Lys What is the one letter code of this amino acid…
A: Amino acids are compounds containing carbon, hydrogen, oxygen, and nitrogen. They are the building…
Q: Which of the following amino acid changes can result from a single base-pair substitution? Explain…
A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…
Q: what is the amino acid of 5’ U A G G C U A C U A C C A G G U A U C G G U C U G A U C U A G C U A G…
A: Proteins are synthesized from mRNA through translation process. In the translation process, the mRNA…
Q: All L amino acids have an S absolute configuration except L - cysteine, which has the R…
A: All amino acids except glycine are chiral. All naturally occurring amino acids are L-amino acids.…
Q: Identify the nucleotide. CH HN 9. N' O. 0-P-OCH2 O DUMP O dGMP O DAMP O dCMP O dTMP
A: Given below is a structure of nucleotide as it contains a base, sugar & phosphate group. The…
Q: Given the fragment Ala-Lys-Tyr-Gly-Phe and Leu-Val-Ser-His-Cys-Arg, what is the expected result in…
A: Biuret test is a test used for detecting the presence of peptide bonds. Biuret Reagent is formed by…
Q: Please clearly identify each numbered amino acid side chain, below. Your description should include…
A: amino acids are the building blocks of proteins . they have amino group , acid group and variable R…
Q: The peptide below NH-CH- HẠN CH- ČH, -NH-CH- NH-CH- NH-CH- OH CH2 CH2 CH2 HN-ç=NH, NH2 CH2 CH HO-CH,…
A: Amino acids are the building blocks of peptides. The net charge on a peptide depends on the sequence…
Q: Write the name of the oligopeptide L-E-T-S-P-R-A-Y using their full amino acid names. Draw the…
A: Amino acids are molecules that serve as monomers for proteins. Each amino acid is composed of a…
Q: fof NH HO-P-O-P-O-F `NH2 ÓH ÓH OH OH OH Which nucleotide is shown in the picture above?
A: A nucleotide is a molecule that is organic, containing a nucleoside and a phosphate. It is the basic…
Q: Identify the following amino acid at pH = 7 (aqueous form): (COO-)–CH(NH3+)–CH2–(COO-) aspartic…
A: Amino acids are the monomers that build up the protein. They are termed as amino acids because they…
Q: Identify the amino acid shown below. (Note: single letter code is provided as answer) H,N-C-COOH CH2…
A: Amino acids are the building blocks of proteins. The building blocks of living organisms are amino…
Q: What are the sequences of all the possibletripeptides that contain the amino acids aspartic acid,…
A: Amino acids are the building blocks of proteins. They contain amino group, carboxyl group, and…
Q: Give the amino acid sequence of an octapeptide that contains the amino acids Tyr, Ala, Leu (2…
A: Introduction: There are 20 known amino acids at present. These are biomolecules that form proteins…
Q: what are 20 different amino acid names explain each of them and explain their 3 letter dimention,1…
A: Biochemistry is a branch of biology that mostly deals with the structure, function, and interaction…
Q: Define ε-amino group
A: The amino group is the -NH2 substituent in a carboxyl group. Amino groups are components of amino…
Q: Identify and match the lettered regions in the titration curve of a basic amino acid. pic 5.jpg…
A: Histidine is an amino acid that has an imidazole ring as the functional group (R group). Thus, the…
Q: Calculate the overall net charge of the following polypeptide at pH = 2.0…
A: Amino acids are compounds containing carbon, hydrogen, oxygen and nitrogen. They are monomers…
Q: Draw the structure of Phe-Ser-Met-Glu, and indicate where the peptide bonds are.
A: Protein is an organic nitrogenous macromolecule that is required for human health. In the human…
Q: The sequence of a peptide is given below. Ala-gly-val-leu-trp-lys-ser-phe-arg-proWhich peptide…
A: Chymotrypsin belongs to a group of enzymes that all use a serine as an active site to cleave peptide…
Q: HO, NH2 HO This amino acid is called It's three-letter abbreviation is and its one-letter…
A: Proteins are the building blocks, made up of amino acids. They are of twenty different types that…
Q: HO NH2 H. ZI
A: Amino acids are organic compounds that consist of an alpha-amino group, a carboxy group, and an R…
Q: Treatment of a polypeptide with 2-mercaptoethanol yields two polypeptides 1.…
A: Given that treatment of a polypeptide with 2 marcaptoethanol yielded 2 polypeptides: 1.…
Q: Draw a tripeptide gly-phe-ala
A:
Q: Draw peptide Pro-Ser-Ala-Phe-Glu as you would see it at pH 7. Include stereochemistry.
A: Proteins are made of different amino acids joined through peptide bonds. The amino acids are…
Q: Ala-Phe-Pro-Cys-Clu-Arg-Arg-Pro-His-Gly-Lys-Clu Calculate the net charge on the polypeptide at a.…
A: Note: There is no amino acid with a three-letter code as Clu. The charge calculation will be carried…
Q: Ile-Ala-His-Thr-Tyr-Gly-Pro-Phe-Glu-Ala-Ala-Met-Cys-Lys-Trp-Glu-Ala-Gln-Pro-Asp-Gly-Met-Glu-Cys-Ala-…
A: Most common secondary are the α-helix and the β-pleated sheet. Both the secondary structure is…
Q: Identify the a-carbon of aminolevulinic acid.
A: Carbon atoms are named from one end of an organic compound. The carbon atom with the substituent…
Q: Identify the amino acid. OH 0=C H2 CH-C H2 -CNH2 NH2
A: Amino acids are the monomers that build polymers called proteins. The amino acids are linked…
Q: What is the 1-letter code for the amino acid glutamine? N E Q G
A: GLUTAMINE l-α-amino acid Formula:- C5H10N2O3. Charge:- neutral (polar amino acid). Function:-…
Q: A B Amino Acid Lysine Abbreviation 3- Letters Lys 1- Letter K pk₁ -COOH 2.18 pK₂ -NHS* 8.95 PKR R…
A: Amino acids are biomolecules where an alpha carbon is bonded to an amine group , a carboxylic group,…
Q: What is the net charge at pH 7 on a peptide with the following sequence?…
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: 61. The correct name of the peptide below is -CH-C- -CH-C- -CH N-ÇH -CH-COH H2N- ČH3 CH-CH3 CH2 CH3…
A: Introduction: The correct choice is option C).
Q: The full name of this amino acid is The 3-letter abbreviation is Please also note the following: •…
A: Amino acids are biomolecules composed of a central carbon bonded to 4 groups. 3 out of these 4…
Q: HN H H H H H Se он
A: Peptides or proteins are composed of twenty standard amino acids attached together via peptide…
Q: Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3' O…
A: Answer :- Met-ala-phe-lys-stop DNA…
Q: From the sequence D-I-LI-G-A-F, how many amino acids are aromatic?
A: Amino acids : There are hundreds of amino acids present in the living organisms. Amino acids are…
Q: Drew the peptide sequence and write its full name Cys-Gln-Lys-His-Ala-Ser-Gln
A: All the amino acids mentioned in the question are linked Together by peptide bonds that is CONH. A…
Q: Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-LEU-LEU-SER DNA Sequence:…
A: Closer the DNA constitution of organisms closer are they in their protein content. One can determine…
Q: Suggest which part of this sequence belongs to the inner part of the protein and which to the outer…
A: Proteins are polypeptides formed of monomeric units-amino acids. There are 20 different amino acids…
Q: Translate the following amino acid sequence into one-letter code:…
A: The unique one-letter code was developed for easy and fast recognition of amino acids. Each of the…
Q: Assign IUPAC names to each of the following small peptides.Gly-Ala-Leu…
A: The international union of pure and applied chemistry (IUPAC) name of a peptide refers to the full…
Q: Identify each amino shown in Fischer projection. Indicate whether the d- or l-enantiomer is shown
A: The amino acid is the smallest subunit of the protein, which helps in the synthesis of peptides.
Q: Does amino acid sequence or amino acid composition have more of an impacts the protien structure?
A: Amino acids are compounds containing carbon, hydrogen, oxygen and nitrogen. They serve as monomers…
Q: Spell out the name of the polypeptide using three letter codes for each amino acid separated with…
A: Phenyl isothiocynate is the Edman reagent. It reacts with N-terminal amino acid to give phenyl…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- Give the correct names for the types of sugars shown below: a. b. CHO HO- -H € H- -OH CH₂OH HO- HO- HO- H- CHO -H -Ċ- -H -C-H -OH CH₂OHIs it a?Which of the following images show a carbohydrate? Note: molecular biologists have many different ways of drawing organic molecules. Click here for a cheat sheet about how to interpret different kinds of diagrams. CH2OH OH ОН ОН оннн ннн нннн ннннн н-о-с-с -с-с-с-с-с-с-с-с-с-с-с-с-с-с-н нннн ннн нннн нннн
- OHHH HHHH H H H HH -с-с-с-с-с-с-с-с-с-с-с-с-с HH H H H H H H H HHH H H H H H H H HHH H-C-O C-C- OH H H H H H H H H-C-0 C-C-C-C CH, H H H,CN-C-c-o-P-0-c-H CH, H H H H H H H H H c-c-c-o What do you call the structure enclosed in the rectangle? What type of chemical bond is represented by the structure with an arrow?. What structure does the bond identified in # 2 create in relation to the entire molecule shown? True or False: This molecule is non-amphipathic. (True or False) I-0-ISecond letter U A G UUU Phe UUC, U UUA UCU) UCC UCA UAU UAC FTyr UGU] UGCCYS UUG FLeu UCG, Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CAU 1 CGU CGC Arg CUU CCU His CÁC S САА CỤC ССС Leu Pro CỦA ССА CGA CUG CCG CAG GIn CGG AAU LAsn AGU ], AUU ACU* AUC }ile A AUA АСC АСА ААС AAA Ser AGC. AGA Thr JArg AUG Met ACG AAG FLys AGG GAU ASP GACS GAA GAGJ Giu GGG) GUU GUC - Val GUA GCU] GCC GGU GGC Ala Gly GCA GGA Glu GUG GCG Given the double-stranded DNA molecule shown below, what is the sequence of the mRNA corresponding to the coding strand (the one that would be made by RNA polymerase reading the template strand). Label the 5' and 3' termini. Coding strand 5'- ТАTGAAАTTTAAATTT -3' Template strand 3'- АТАСТТТАААТТТАAA — 5' а. What are the amino acid sequences encoded peptides by the three possible reading frames? Please write your answer like this: Pro-His-Stop-Leu etc. Reading frame 1 starts with the first 5' nucleotide. ORF1: Enter your answer here ORF2: Enter your answer here ORF3: Enter…1 2 3 4 NH2 NH2 NH2 Н-с H-c CH2 H-C H-C N NH2 CH2 H-C N-C CH2 CH2 H \H H/ \H H/ С — С H H H/ OH H но но 6. 7 NH2 NH2 NH2 H-C H-C CH2 H-C H-C CH2 CH2 CH2 NH2 \H H/ H H/ H \H H/ \H H/ H. OH H Он Он н но 6. 10 H-C H-C CH2 NH2 CH2 NH2 ターC \H H/ \H H/ он ОН он он Which of these molecules could be incorporated into primer during DNA replication? Select all that apply: 11. I. 4 IV. V. VI. VII. 8. YII. O =U