See the oligopeptide below. Compare the quantities of high energy molecules (e.g. ATP/ADP/AMP, NAD+/NADH, NADP+/NADH, FAD/FADH2, FMN/FMNH2, etc.) absorbed and produced throughout their catabolism — from absorption to ATP synthesis. What is the net ATP yield from the chosen glucogenic and ketogenic amino acid breakdown?

Q: Which of the following is NOT true of a competitive inhibitor? A) Its effects can be overcome by…

A: Competitive inhibitor- It competes with the substrate for the active site of an enzyme, while the…

Q: Discuss the role of carbohydrates on cancer and suggest an appropriate treatment

A: Carbohydrates are biomolecules, which are the primary source of energy for the body. All of the…

Q: 2. Oxidation of galactose with conc HNO3 yields a. Galactaric acid b. Glucuronic acid c. Saccharic…

A: There are different chemical reactions involving a variety of saccharides or carbohydrates which…

Q: 15. Cellular proteins are oftentimes post-translationally modified. Choose one of the following…

A: Post translational modification are the modifications done in the protein by covalently attaching…

Q: For the tetrapeptide KASE: a. Draw its complete protonic equilibria. Indicate the net charge of each…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,…

A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…

Q: Which of the following concerning hemoglobin is true? a) BPG decreases at high altitudes and causes…

A: 1 Hemoglobin is a globular protein, ie it is roughly spherical. It is an oxygen-binding protein that…

Q: 3. (a) The beakers below represent different conditions for measuring the initial velocity (vo) of…

A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…

Q: Glycolisis is process that is reversible, meaning that any product that is being formed can easily…

A: During the catabolism of amino acids, for it to be used as a respiratory substrate, first the alpha…

Q: Complete the reaction above by drawing the structure of PEP. Draw the molecule by placing atoms on…

A: Enolase is an enzyme that reversibly catalyze the dehydration of 2-phosphoglycerate to…

Q: 15.5 Identify the acid-base conjugate pairs in each of the following reactions: (a) CH₂COO + HCN (b)…

A: An acid is defined as the donator of protons and a base is defined as the acceptor of protons. Acid…

Q: Suppose that the pH of distilled water is 6.2, what will be its resulting color using phenol red.

A: The pH of a solution refers to the H+ ion concentration in the solution. A solution with a pH lower…

Q: Which of the following is NOT a naturally-occurring amino acid? A) B) C) D) H₂NCH-COO CH3 H₂NCH-COO…

A: The proteins are composed of twenty naturally occurring amino acids. These amino acids are alpha…

Q: Which statements best describe serotonin? Select the correct response(s): It is essential for…

A: Serotonin is a neurotransmitter that is important for inducing sleep, for modulation of memory,…

Q: is the statement true or false?

A: The pentose phosphate pathway carries out the complete oxidation of glucose by completely oxidizing…

Q: Conversion of disaccharides to monosaccharides are associated with: O stomach O intestinal mucosa…

A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…

Q: 7. What conclusion can you make about the effect of pH on the enzyme activities? Which part of the…

A: Enzymes are usually protein molecules which work as a catalyst and increases the rate of reaction by…

Q: 4) a) Draw the peptide ASYTL at pH 7 and 12. b) Draw a Titration Curve for this peptide. c) If this…

A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…

Q: What is most correct about the following inhibition? Penicillin

A: The antibiotic penicillin irreversibly binds to and inhibits the activity of the transpeptidase…

Q: What charged groups are present in glutamate at a pH = 7? OA) 1× NH3+ B) 1 x COOT C) 1× NH3 and 1 x…

A: Glutamate is an amino acid with molecular formula C5H9NO4. It is considered as acidic amino acid due…

Q: Does glycolysis take place in the presence or absence of oxygen?

A: Glycolysis is a metabolic pathway which occurs inside the cell in which glucose is breaken down for…

Q: For the amino acid tryptophan: Draw its complete protonic equilibria. Indicate the net charge of…

A: The proteins are composed of twenty naturally occurring amino acids. The net charge on an amino acid…

Q: DNA: Explain nick translation and strand displacement

A:

Q: You've got a solution containing 60 μM VIP (very important protein). VIP binds to its ligand L with…

A: Ligand-protein interactions are best described by their Dissociation Constants (KD). Let us…

Q: Which of the following statements about oxidative phosphorylation is correct? OH* ions are…

A: Introduction ATP is synthesised in the mitochondria of a cell by a process called oxidative…

Q: DNA: Whats the difference between continuous and discontinuous synthesis, why replication requires…

A: DNA is Deoxyribo Nucleic acid which functions as genetic material in most of the organisms.…

Q: Which of the following laws of matter best describes the statements on sulfide minerals? Select one:…

A: INTRODUCTION : Sulfide minerals -  They are a class of minerals consisting of sulfide or disulfide…

Q: Given the following reaction and equation for the initial velocity of the reaction: k₁ k3 E+SES E +…

A: We are given two equations for initial velocity (V). V=kcat [ES]    -------(eq1)       andV=k3 [ES]…

Q: 29. What is the action of the Na/K pump? A. It is bidirectional for both ions B. It actively…

A: Introduction Plasma membrane or cell membrane is a outermost membrane in animal cell. It protect the…

Q: Propose a pathway for the following compound to enter gluconeogenesis / glycolysis. In your pathway,…

A: Glycolysis is a collection of 10 enzymatically catalysed reactions that sequentially oxidise a…

Q: In the peptide, SWEETLY, bond via its side chain. (Give the full name of the amino acids) can still…

A: Recall that: for a given peptide amino acid sequences are written with N-terminal amino acid on the…

Q: Which of the different carbohydrate tests would give a positive result for maltose? Describe the…

A: Maltose is a disaccharide composed of 2  D-glucose molecules. The bonding pattern is α-1,4 . Hence…

Q: Procedure 1. Place 2mL of milk in each of the 3 test tubes. 2. Heat one of the test tubes to boiling…

A: Test tube 1 contains once boiled (then cooled) milk , formaldehyde and methylene blue . Test tube 2…

Q: Name the three major types of membrane lipids in animal cells and provide a specific example of…

A: The cell membrane is composed of lipids and proteins. A small amount of carbohydrates is also…

Q: How does mottling on tablets appear during drying process? Give your insights on how mottling can be…

A: Introduction During tablet processing different types of defect may arise. An tablet should be free…

Q: Complex carbohydrates are comprised of which of the following? Disaccarides Oligosaccarides…

A: Carbohydrates are biomolecules composed of carbon, hydrogen, and oxygen. Carbohydrates are…

Q: DNA: Whats the structural and functional differences between heterochromatin and euchromatin?

A: DNA, the genetic material is organized as chromosomes inside the cell nucleus. The chromosomes have…

Q: Describe the signal transduction pathway for Two or Three of the following: a) ß-adrenergic…

A: Beta adrenergic receptor is a  G-protein-coupled receptor communicating through the Gs alpha…

Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…

A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: Peter has been playing Volley Ball for 2hours now and he is very tired. He is now going home to…

A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…

Q: ● What are the three things we need to know in order to begin to understand the way an active site…

A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. The substrate binds…

Q: write the mechanism for the reaction of CO2 and the amino terminal of the alpha-1 chain of…

A: Hemoglobin is a multimeric protein that transports oxygen and CO2 in the body. A hemoglobin molecule…

Q: Question 21 of 25 What are Gram-negative bacteria? Select the correct response(s): They have a cell…

A:

Q: Can you please Draw what this should look like. Chromosome Model Procedure for making a solid wire…

A: Chromosomes The histone proteins H1, H2A, H2B, H3, and H4 assist the DNA to be compressed and…

Q: Which of the following enzymes requires Mg2+ to carry out its function? Alcohol dehydrogenase.…

A: An enzyme draws substrates to its active site, catalyzes the chemical reaction that creates the…

Q: Discuss how to determine the elements of proteins and its reactions.

A: Proteins are the most abundant biomacromolecule of life. Proteins are primarily polypeptide…

Q: In biochemistry, what is definition of buffer , which amino acid can act as buffer? what is buffer…

A: The functioning of many molecules such as proteins, nucleic acids etc. depends on pH. The pH in…

Q: In the free energy diagram below, molecule A (with energy x) is converted to molecule B (with energy…

A: Activation energy for a reaction is the minimum amount of extra energy that is necessary for the…

Q: 12. The graph shows values of arterial plasma bicarbonate concentration and pH for different persons…

A: Metabolic alkalosis is caused by acid base imbalance in the blood. It is characterised by increase…

Q: (a) (b) (c) Draw the structure of the final DNA product for this reaction. Draw a square around the…

A: Nucleases are enzymes that degrade polynucleotides. Depending on the substrate they cleave, they can…