Select the chemical consequences that could contribute to DNA instability at AP sites. fewer hydrogen bonds between the unpaired pyrimidine base and water disruption of the base-stacking interactions increased ability of the deoxyribose ring to open without the attachment of the purine base decreased interaction between the mutated DNA strand and histones

Select the chemical consequences that could contribute to DNA instability at AP sites. fewer hydrogen bonds between the unpaired pyrimidine base and water disruption of the base-stacking interactions increased ability of the deoxyribose ring to open without the attachment of the purine base decreased interaction between the mutated DNA strand and histones

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Hydrolysis of the N-glycosyl bond between deoxyribose and a purine base in DNA creates an apurinic (AP) site. An AP site is more thermodynamically destabilizing to a DNA molecule than is a mismatched base pair. Examine the structure of an AP site. H₂N HN N O™ -O-P-O-CH₂ Guanine H₂N N HN Select the chemical consequences that could contribute to DNA instability at AP sites. H H 1₂0/ H fewer hydrogen bonds between the unpaired pyrimidine base and water disruption of the base-stacking interactions decreased interaction between the mutated DNA strand and histones increased ability of the deoxyribose ring to open without the attachment of the purine base H H Guanosine residue (in DNA) O™ -O-P-O-CH₂ O H H H O Apurinic residue H OH H
Hydrolysis of the N-glycosyl bond between deoxyribose and a purine in DNA creates an AP site. An AP site generates a thermodynamic destabilization greater than that created by any DNA mismatched base pair. This effect isnot completely understood. Examine the structure of an AP site anddescribe some chemical consequences of base loss.
Snake venom phosphodiesterase hydrolyzes nucleotides from the 3' end of any oligonucleotide and cleaves between the 3' hydroxyl of the ribose or deoxyribose and the phosphoryl group of the next nucleotide. It acts on single-stranded DNA or RNA and has no base specificity. Which nucleotide would be released first from the oligonucleotide shown below upon treatment with snake venom phosphodiesterase? choices a. Deoxythymidine 5'-monophosphate b. Deoxyguanosine 3'-monophosphate c. Deoxyguanosine 5'-monophosphate d. Guanosine 5'-monophosphate e. Deoxythymidine
DNA is damaged when a base from the DNA chain is removed after an alkylation has occurred. In a depurination reaction, the purine nitrogenous base is displaced from its sugar as shown in this reaction. Draw the mechanism for this reaction and suggest a reason why it occurs so easily. HN' P H2N .N H,O HN° + Pi ОН N- H2N° ОН ОН ОН ОН
The enzyme creatine kinase catalyzes the ATP-dependent phosphorylation of creatine. Propose a mechanism for the reaction described using the curved arrow convention. Show the complete structure of the nucleotide.
Describe the functions of the following proteins during DNA breaks and repair: (i) Ku70 (ii) Uracil DNA glycosylase
Given the structures of the ribonucleotides and deoxyribonucleotides: Adenine Uracil Thymine HN Adenine NH HO-P-0- CH2 HO-P-0 CH2 HO-P-0-CH2 HO-P-0-CH он он он он OH H OH H Cytosine Cytosine Guanine Guanine NH2 NH NH2 CH2 HOo CH2 HO-P-0 -CH2 он он он он OH H OH H • Draw the structure of the polyribonucleotide UAGCCUG. Draw the structure of the polydeoxyribonucleotide CGTAGAT.
Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop
Enediynes are natural products with potent antitumor properties because they are able to cleave DNA (page 288). Their cytotoxic properties are due tothe enediyne undergoing a cyclization to form a highly reactive diradical intermediate. The intermediate abstracts hydrogen atoms from the backbone of DNA, which triggers its damage. Draw the structure of the diradical intermediate.
The joining of a new nucleotide to a growing strand during DNA synthesis leads to the formation of a phosphoester bond and involves O a nucleophilic attack of the terminal P atom of the growing strand on the electrophilic 3-0 atom of the growing strand O a nucleophilic attack of the terminal 3'-0 atom of the growing strand on the electrophilic P atom of the incoming nucleotide O an electrophilic attack of the terminal 3'-O atom of the growing strand on the nucleophilic P atom of the incoming nucleotide an electrophilic attack of the terminal Patom of the growing strand on the nucleophilic 3-O atom of the growing strand
5-Bromouridine is known to induce mutations in DNA. One of the characteristics of this compound is that the enol form is favored relative to the keto form. Draw the keto- and the eno- tautomers of the base. Determine (and draw) which base (A, T, G, or C) would most likely interact with each of the two forms by base-pair.
Identify the correct name or abbreviation for the given nucleoside or nucleotide. guanosine ADP dADP dGDP GDP Identify the correct name or abbreviation for the given nucleoside or nucleotide. GDP dADP ADP O deoxyadenosine dGDP OMP O || -O-P-O-P-O. fot O™ tt -O-P-O- O™ ܘ ܐ ܘ ܐ OIPIO N OH OH OH N H₂N N ΝΗ N NH₂