Answered: Select which statements are true 1. if…

Science

Biology

Select which statements are true 1. if oxygen concentration in the lumen of the colon increases, this

Ebk:Nutrition & Diet Therapy

10th Edition

ISBN:9780357391747

Author:DEBRUYNE

Publisher:DEBRUYNE

Chapter19: Carbohydrate- And Fat-modified Diets For Malabsorption Disorders

Section: Chapter Questions

Problem 4SC

See similar textbooks

Related questions

Q: In a monohybrid cross, which of the following can result in the heterozygote displaying a different…

A: Everyone wonders why brothers and sisters look so similar to one another. This is when heredity…

Q: Which of the following statements reflect the difference between RNA and DNA? Multiple answers:…

A: Introduction The process through which a gene's information is used to create a functioning gene…

Q: Translate the mRNA into a protein using the genetic code. (Amino acid chain.) AUG( met)-UUU(…

A: Introduction The genetic code is a set of instructions that enable live cells to produce proteins…

Q: W S Rehpogs are mythical creatures. They are small and not very smart. Rehpogs live on the ground in…

A: Changes in gene frequency in a population can occur due to 4 reasons- Migration Mutation Natural…

Q: in which way do cells use glucose during the production of ATP

A: The ability to accomplish work is defined as energy. While there are many different types of energy,…

Q: If a polymorphism is found at a low frequency globally, but has a high frequency in a particular…

A: Polymorphism:- it represents the two or more than two variants of a particular DNA sequences or gene…

Q: Which of the following statements is NOT TRUE about membrane transport? to facilitate movement of…

A: The plasma membrane is permeable only to certain molecules. This means that the membrane allows some…

Q: Developing morbid obesity seems to require that individuals have a biological predisposition to gain…

A: Obesity can be transferred by gene from one generation to another generation. There have such genes…

Q: Different recommended BMI ranges exist for people of different ethnic groups. This is partially due…

A: Answer : True

Q: Sickle cell anemia affects red blood cells by causing them to delivered efficiently to all parts of…

A: Red blood cells are present in the plasma of blood. The blood is a specialised connective tissue. It…

Q: Which of the following statements is NOT TRUE about membrane transport? to facilitate movement of…

A: The cell Membrane or Plasma membrane is an external cell layer that acts as a selective barrier as…

Q: Upper Intertidal Zone Lower Intertidal Zone Balonus kalenvides Chthamalus scellatus The diagram…

A: Introduction: Connell is an American ecologist, but because his research on how interspecific…

Q: Answer the given situation below; a. Bob says that he is healthy and has no genetic diseases such as…

A: Introduction: Genes are a set of instructions that determine what the organism is like, its…

Q: Deﬁne speciation and the role of genetic divergence among populations in creating new species.

A: Speciation is the emergence of new species in a given population. It creates reproductive isolation.…

Q: a) Use this data, and sketch a graph by hand that would best fit the data. (think which type of…

A: Aurelia Aurelia commonly known as jellyfish because of its jelly like materials from which it is…

Q: Use the image below to answer questions 2-3. As part of his series of experiments, Connell removed…

A: Introduction : A genus of barnacles in the family Balanidae in the subphylum Crustacea is called…

Q: 1. You accidentally used safranin as the primary stain and malachite green as the counter stain…

A: A stain is a chemical substance used in the laboratory to add color to the cell. This is used for…

Q: Name the four compartments of the stomach of ruminant. Which two are located primarily on the left…

A: Ruminant animals, such as, cattle, goat, deer, horses, camels, possess a special type of stomach,…

Q: Is there any form of matter or energy that could never be considered pollution? Briefly compare and…

A: Our modern lifestyle renders us more susceptible to many illnesses. With increased pollution and bad…

Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU

A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…

Q: Weight loss increases the plasma concentration of organochlorides in the blood. Organochlorides…

A: During exercise, our muscles burn ingested food for energy and contract in response to a flood of…

Q: A. Drawing of Cell in Distilled Water Mount: (with Label) H₂₂0 H₂O H₂O H₂0 Drawing of Cell in Normal…

A: Figure A is of The cell is in isotonic solution. The flow of water is from both the side until…

Q: The is morphological difference between bipolar neurons and unipolar neurons and that determines how…

A: As you are reading this book, think about the organs that are functioning within you right now! Your…

Q: Answer it. In Seminal Fluid Analysis, what are aspects of semen that are assessed microscopically?

A: Sperm The male gamete that is motile and fertilize female gamete.

Q: Answer the following 1. Why was Anton van Leeuwenhoek's discovery is important? 2. What is the…

A: Introduction: The natural world was finally explained by experiments and scientific observations…

Q: 3 Allele distributions in Generation 1: 36 homozygous dominant individuals 13 heterozygous…

A: Given p+q = 1 p2 + 2pq + q2 = 1 q = 0.4

Q: Compared to fat, muscle is: a. Denser and less metabolically active b. Denser and more…

A: Muscles Muscles are the soft tissue that help in the movement of body.

Q: This type of cell transport does not require energy for the molecules to be transported. Passive…

A: Passive Transport Movement of molecules across cell membranes which requires no metabolic energy and…

Q: Sickle-cell anemia is a human disorder caused by a recessive allele (HbS) for the hemoglobin gene…

Q: How do organisms with less complex systems such as those in protozoans are able to respond to…

A: Introduction Stimuli are detectable change in the internal or external environment. which causes a…

Q: Explain cell theory in three sentences.

A: Introduction : A cell is the basic structural and fundamental unit of life. Cells are the building…

Q: Listen Tissue damage most likely is happening in which of the following items? Laser light scattered…

A: Laser light can interact with tissues in four different ways: transmission, scatter, absorption, and…

Q: QUESTION 3 In Mendel's pea plants, round shape (R) is dominant to wrinkled shape (r), and yellow…

A: The inventor of modern genetics, an Austrian monk named Gregor Mendel, developed his rules of…

Q: Lipoproteins like LDL and HDL transport lipids and proteins through the blood stream. Receptors on…

A: A lipoprotein is a biochemical assemblage whose main job is to move fat molecules in water that are…

Q: What is the purpose of checking the %GC in our NGS data? What is the ideal %GC value? Explain why…

A: Next Generation Sequencing is a DNA sequencing methodology by which the order of nucleotides in DNA…

Q: algal photosynthesis

A: Photosynthesis: It is defined as the process of conversion of light energy to chemical energy…

Q: A. Let us see if you can help Draky, who traveled from home to his work using bicycle, but has been…

A: Given, Blood group of mother = O Blood group of father = A

Q: Why would you use one single colony for both streaks on a plate and inoculate a culture for plasmid…

A: Introduction Plasmids are important for the transformation of bacteria. They are used as vectors and…

Q: Which of the following is the best description of a ligand? - A molecule that directly binds a…

A: Introduction : A cell, tissue, or organ that can recognise and react to a specific stimuli is said…

Q: Briefly explain how protein breaks down in the body How do enzymes affect the proteins that we ate?…

A: Enzyme The protein molecules which act as catalyst in biological reactions.

Q: skin color

A: Skin color: Skin color is determined by the pigment called Melanin even other things are also…

Q: factors influencing the phenotypes of adult animals and explain.

Q: Read the article on the bat's wings (link below). The author seems to disagree that evolution is…

A: "Evolution is the concept of similarities among organisms indicating a common ancestor to which all…

Q: Which factor sets the upper limit of Chthamalus' realized range in the intertidal zone? O Ability to…

A: Introduction :- The area that is above water at low tide and below water at high tide is referred to…

Q: In the garden shed belonging to one of this text’s authors, stabilizing selection has occurred over…

A: Natural selection is the variation in individual survival and procreation brought on by phenotypic…

Q: In endocrine signalling Only nearby cells are affected by the hormone Steroid based hormones are…

A: Signalling:- cell signalling may be categorised into various categories such as endocrine,…

Q: This type of cell transport happens during secretion of hormones, neurotransmitters and digestive…

Q: substance that do not dissolve well in water are a. hydrophobic b. hydrophilic c.isotonic…

A: Introduction :- An substance that is attracted to water molecules and has a propensity to dissolve…

Q: Whay does level 2 in Biosafety Cabinet Lever 2 mean? Why is it importnat to do the experiment in…

A: Introduction: The term biosafety cabinet, sometimes known as a biological safety cabinet, or…

Q: Pasteur used an S-necked flasks to disprove spontaneous generation. Explain the experiments that…

A: Spontaneous generation is a hypothesised theory that attempted to explain the origin of life…

Concept explainers

Tissue renewal

In multicellular organisms, tissue is a level of structure that consists of a group of physically and functionally identical cells and their intercellular substances. Unicellular organisms do not have tissues. Tissues are absent or poorly differentiated even in the simplest multicellular animals, such as sponges. However, more evolved multicellular animals and plants have specialized tissues that may organize and govern an organism's reaction to its surroundings. The word tissue is derived from the Latin word 'weave.' Plants and animals have various kinds of tissue systems that differ in their work and composition according to the different requirements.

Question

Microbiology: Select which statements are true

1. if oxygen concentration in the lumen of the colon increases, this could decrease lumenal short chain fatty acid concentration

2. consuming diverse insoluble dietary fibers can promote increased digestive bacterial diversity, thus affecting the abundance and ratios of short chain fatty acids produced

3. fiber that is indigestible to humans is the most likely carbon source used for producing SCFAs

4. obligate anaerobes are more likely found in small intestine than in colon, because small intestine has higher levels of oxygen

5. less complex carbs (sucros, lactose, glucose,) are likely less abundant in the colon than in stomach or begging of small intestine.

Study of lifeforms too small to see with the naked eye, including bacteria, viruses and protozoans. Microbiologists may study bacteria, yeast, or other microbes to understand better their reproduction, life cycle, or role in causing disease.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Explain this The basic nutritional requirements of microorganisms are an energy or carbon source, an available nitrogen source, inorganic elements, and for some cell types, specific growth factors.
. A certain medium has the following composition: Glucose 15 g Yeast extract 5 g Peptone 5 g KH2PO4 2 g Distilled water 1,000 ml Tell what chemical category this medium belongs to, and explain why this is true. How could you convert Staphylococcus medium (table 3.6A) into a nonsynthetic medium? a. Name four categories that blood agar fits. Alpha hemolysis Beta hemolysis Gamma Alpha prime Name four differential reactions that TSIA shows. Observe figure 3.15. Suggest what causes the difference in growth pattern between nonmotile and motile bacteria. Explain what a medium that is both selective and differential does, using figure 3.18. a. What kind of medium might you make to selectively grow a bacterium that lives in the ocean? MSA Mannitol salt agar One that lives in the human stomach? Why are intestinal bacteria able to grow…
Food safety: a. Explain whether there is a greater risk for E. coli O157:H7 infection when consuming a hamburger compared to consuming a steak. b. Also, discuss whether or not food poisoning can still occur after consuming a reheated pot of soup known to be contaminated with Staphylococcus aureus.
A. Explain why it is essential to digest all wild-type pQE. 1.-CRYGD. B. How would you make 50 mL o 1% weight per volume (w/v) agarose solution?
The basic nutritional requirements of microorganisms are an energy or carbon source,an available nitrogen source, inorganic elements, and for some cell types, specific growth factors. Explain this statement
a. Compare the ancient prokaryotes, their environment and metabolism, with the prokaryotes that exist today. Illustrate your answer with examples of specific microbial species, and the different metabolic pathways they use in each type of habitat. 2 of the
UHU UNIVERSITY HOSPITAL BED # 1 DATE: 8/30 TIME: 1700 ADMISSION DATABASE Yellow PRIMARY PERSON TO CONTACT: Name: Maria Rodriguez DOB: 12/19 (age 38) Physician: A. Gustaf, MD ☐ Green ☐White Name: Emilio Santiago (brother) TRIAGE STATUS (ER ONLY): ☐ Red Initial Vital Signs Home #: 555-212-7890 TEMP: 102 RESP: 32 SAO2: HT (in): WT (lb): 110 5'2" UBW 145 B/P: 78/60 PULSE: 68 LAST TETANUS 5 years ago LAST ATE yesterday LAST DRANK water 1 hour ago Work #: 555-213-4563 ORIENTATION TO UNIT: ☑Call light ☑Television/telephone ☑Bathroom ☑Visiting ☑ Smoking ☑Meals ☑Patient rights/responsibilities CHIEF COMPLAINT/HX OF PRESENT ILLNESS "I found out I had an ulcer 2 weeks ago. Last night I seemed to have gotten worse. I have been vomiting, and I have diarrhea. My pain is terrible. I think I have blood in my vomit and my diarrhea." ALLERGIES: Meds, Food, IVP Dye, Seafood: Type of Reaction Codeine causes nausea and vomiting. PREVIOUS HOSPITALIZATIONS/SURGERIES For delivery of her two daughters only…
Food poisoning can be divided into two categories: food infection and food intoxication. On the basis of toxin production by bacteria, explain the difference between these two categories.
C. Why do we grow E.Coli at 37-celsius degrees? What is this in Fahrenheit? What else is roughly this temperature?
a. Explain how osmotic pressure and pH are used in preserving foods.b. What effects do they have on microbes?
Note : Organism - Enterobacter aerogenes General characteristics of the organism. Describe basic characteristics of your organism. You may include types of metabolism, classification, ecological roles, and results of biochemical tests and staining. 2.Relation to human health. Discuss how your organism is pathogenic or beneficial to humans. 3.Every organism is unique! Provide some interesting facts or details you find fascinating about your organism. Some ideas are historical information, disease outbreaks, useful applications, or personal encounters with the organism. Please not straight from the google thank you !
f. Which type of milk, the carabao or cow’s milk, would give farmers orcheese-makers a higher profit? Explain why.g. Why is toxicological evaluation important in using microbial rennet forcheese production?h. Describe the two forms of microbial “BIOTECH” rennet that arecommercially available. What are the pros and cons of using the pelletand the liquid form?i. Enumerate and describe each process involved in cheese-making using themicrobial rennet.