Answered: Show your work! 8. In an NMR study of a…

Show your work! 8. In an NMR study of a sample of polystyrene, it was determined that (mm) = 0.40 and (mr) = 0.10. What is the % isotacticity of this sample? %3D A. 25% B. 50% C. 45% D. 30%

Fundamentals Of Analytical Chemistry

9th Edition

ISBN:9781285640686

Author:Skoog

Publisher:Skoog

Chapter32: Gas Chromatography

Section: Chapter Questions

Problem 32.17QAP

See similar textbooks

Related questions

Q: 5) When you consider the voltammetric techniques, how is polarography different than the others?…

A: 5. THE SHAPE OF THE POLAROGRAPHY IS OF SIGMOID SHAPE IT IS ELECTROANALLY TECHNIQUE THAT IS APPLIED…

Q: Crud Chemicals is producing a casting resin that can be made using either (i) AA and BB monomers or…

A: In both polymer and gel there is cross linking .But in polymer the crossling bonds are either…

Q: Which of the ff. wavelengths may be used for turbidity measurements? 860 nm 500 nm 370 nm 240 nm

A: The wavelength applied in the turbidity measurement are usually in the near infrared range (700nm-…

Q: Chemistry how would i dilute a 50 mM stock to make a 5mM stock?

Q: The mol/L concentrations of styrene (M1) and acrylonitrile (M2) used for copolymerization, and % by…

Q: Explain how XPS can be used to identify the compositions of the material in the layers below the…

Q: How to determine the number average molecular mass of a polymer by: 1. Gel permeation…

A: Polymers are molecules with a high molecular mass and a large number of repeating structural units.…

Q: High L/G ratios result in high operating costs of SO2 scrubbing. Why?

A: Generally, incinerators or large furnace and fossil-fuel power plants consist of SO2 scrubbing…

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: When an equilibrium step-growth polymerization is 99% complete, what fraction of the reaction…

A: Step Growth Polymerization: These are a type of polymerization reaction where step wise, first…

Q: Text Box: 0.2 g of a volatile liquid on complete evaporation occupied a volume of 30 cm3 at standard…

A: The volume occupied by one mole of a substance at constant temperature and pressure is called molar…

Q: Why should we use quartz cuvettes for measuring absorbance in the UV range and plastic cuvettes in…

A: Cuvettes, a small tube-like container that is transparent and sealed at one, open at the other is…

Q: Why does a solid form at the interface of the two solutions? PROCEDURE Synthesis of Nylon In a…

A: Given that, the synthesis of Nylon-6,10. We have to tell why the solid polymer formed at the…

Q: A-Compare between effective of plasticizers and fillers when add to polymers = B:- Determine values…

Q: 4.Magnetic property Ir°: (Xe) 6s² 4f14 5d7 [Ir(NO2)613- [ Select ] [IrBr3- 5. Both [Ni(CN)4]²- and…

A: 4. (II)

Q: 17. What is the Ceiling and fluidity temperature ? 18. This polystyrene has a number average…

A: "Since you have asked multiple question, we will solve the first question for you preferably. If you…

Q: Describe the injection moulding process and distinguish between the injection moulding of TP and TS…

A: Injection moulding process is a method in which plastic materials are injected and are heated or…

Q: Q14: If you are given 3 samples of polypropylene (pp), one isotactic, one syndiotactic and one a…

Q: This graph shows an absorbance vs concentration curve for Co2"(aq) solution. Sample Standard Curve…

A: The absorbance v/s concentration curve given is,

Q: What is the stationary phase in thin layer chromatography and its polarity? Choices: Cellulose -…

A: In thin layer chromatography(TLC) silica is used as stationary phase. Silica is a polar adsorbent .

Q: What monomers would you use to produce analogous polyester fibers?

A: Nylon is a synthetic polymer composed of repeating units linked by amide links. Whereas, polyesters…

Q: What is the advantage of using Buchner filtration in filtering crystals? Q4. Briefly explain how…

A: Solution : Buchner filtering system consists of mainly three parts 1) The Funnel 2) The flask 3) The…

Q: 24 The volume tric Karl Fischer method is suitable for samples with a high water content. 7…

A: THE ANSWERS ARE :- (36) TRUE. (37) FALSE. (38) TRUE . (39)…

Q: You want to understand the components in your polymer composite as a function of temperature. Which…

A: TGA is abbreviated as thermogravimetric measures the mass of a sample while the sample is heated or…

Q: A device to understand how iron behaves at high temperatures we want to design. This device (with 1%…

A: The volume of the unit cell of the iron before transforming is: VHMK = (a0)3 = (0.2863 nm)3 =…

Q: If a polystyrene sample gave a number average molecular weight of 300,000 Dalton and a…

A: Polydispersity index can be denoted by symbol PDI.

Q: Chemistry 1.A fabric specimen weighs 2.341g when completely dried and 2.495g under standard…

A: Given that, for a fabric specimen The weight of the completely dry sample is D = 2.341 g. The…

Q: Briefly describe what is thermoplastic, thermoset plastic and elastomer. Give examples to clarify…

Q: What woukd the TLC plate look like if you used a less polar solvent? (draw the three spots on the…

A: If the solvent is less polar than the compounds will not be able to move up in the TLC plate. Hence,…

Q: 1. n-heptan sample a good lubricating oil? Explain your answer

A: As per our community guidelines, as you have posted two questions and haven't specified which one…

Q: 9. Use the equation in the Beer's Law plot below to calculate the concentration of an unknown…

A: Beers law is a relation between Absorbance vs concentration of the species. Given Beers plot…

Q: 2. Calculate the retardation factors for each of the standards using the TLC plates shown. For full…

Q: Show your work! 8. In an NMR study of a sample of polystyrene, it was determined that (mm) = 0.40…

A: polystyrene is a widely using commercial polymer. Tacticity of a polymer is the order of…

Q: Chemistry Calculate Mn Mw Mz n1 100 80 70 50 30 M1 50 40 30 20 10 Example 2. Calculate Mn, Mw for…

A: The number average molecular weight can expressed as: Mn=∑niMi∑ni where, n is the number of…

Q: C. PARAFFIN 1. Place a paraffin about the size of a rice grain in a dry test tube. Warm gently and…

A: Paraffin is a petroleum product. It is a highly branched saturated hydrocarbon of alkane class. So,…

Q: Which is correct? Random errors affect accuracy and systematic errors affect precision.…

A: Since you have posted multiple questions in a session, we are entitled to answer first question…

Q: How is a sample of a polymer taken for characterization & analysis?

Q: How does capillary zone electrophoresis (CZE) works.

A: Capillary zone electrophoresis is a technique used for separating the individual components from a…

Q: ANION ELIMINATION TEST OBSERVATIONS ADDED REAGENT(S) OBSERVATIONS Ba(NO3)2 NVR HNO3, Fe(NO3)3 Blood…

Q: In a GC experiment, a 30.00 m long fused silica capillary column produced 150,000 theoretical…

A: Calculate the plate height for the given problem which contains number of plates, length and height…

Q: CSH9N .4 2114 3295 IR Spectrum (liquid film) 1200 2000 1600 V (cm' ) 4000 3000 800

Q: Determine whether the first part of statement will INCREASE, DECREASE or have NO EFFECT in the…

A: 1 Overall charge remain constant 2 decrease The higher the molecular weight the greater the…

Q: 5. About 2D defects; (a) Is surface energy greater, the same as, or less than the grain boundary…

Q: the stationary phase used in the given setup is silica, which is more polar between A or B?

A: Given is chromatographic colum and this process is used to seprate two or more components.

Question

solve the question given in the image asap.

Show your work!
8. In an NMR study of a sample of polystyrene, it was determined that
(mm) = 0.40 and (mr) = 0.10. What is the % isotacticity of this sample?
%3D
A. 25%
B. 50%
C. 45%
D. 30%

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, chemistry and related others by exploring similar questions and additional content below.

Similar questions

Show your work! 8. In an NMR study of a sample of polystyrene, it was determined that (mm) = 0.40 and (mr) = 0.10. What is the % isotacticity of this sample? %3D A. 25% В. 50% С. 45% D. 30%
5. Explain the determination of molecular weight of polymer samples usingdilute viscosity measurement.
3. Is the atomic density on the (100) plane of GaAs larger than the atomic density on the (111) plane of Si? Show. 4. What is the simple definition and formula of mobility? Is the mobility of
3. Show that the packing fraction of BCC is 0.68.
The unit cell of the tetragonal (a = b not equal to c) phase of a Ni and Nb alloy is given below a. Is there a 4-fold rotational axis of symmetry parallel to the a-axis? Show your answer. b. Is there a 4-fold rotation axis of symmetry parallel to the c-axis? Show your answer. c. Is the center of the unit cell an inversion center? Show your answer.
6. why is the segmental mobility of a polymer reduced by the presence of the filter?
What is the advantage of using Buchner filtration in filtering crystals? Q4. Briefly explain how scratching the wall of the glass flask can help formation of crystals.
9. Alumina coated TLC plate and a non-polar mobile phase were used to separate A, B and C substances. Arrange the below substances according to their increasing polarity. B
6. Using structure factor rules, show that the selection rules for BCC crystal is h+k+l=even. Also show what are the reflection planes that are Bragg active?
Compute the planar packing factor for the crystallographic plane indicated by a ye boundary on face of the pyramid shown below. Answer Format: X.XX Unit: Unitless Note you are reporting the fractional value here (do not multiply the ratio by 100% / do not convert the response to %).
(d) Crystalline polyethylene has a density of 1000 kg m³ and amorphous polyethylene a density of 865 kg m3. Calculate the volume fraction crystallinity of a sample of branched polyethylene which has a density of 900 kg m. Why is the crystallinity of this sample so low?
This method of preparing nanomaterials from bulk structures wherein it involves the deposition of nanoparticles on a surface through ion or atom bombardment. a. laser ablation b. sputtering c. sol-gel d. pyrolysis