Q: -Onion skin
A: Onion provide an excellent source of vitamins A, C, E, and numerous antioxidants
Q: In earlobes, free (F) earlobe is dominant while attached (f) earlobe is recessive. What proportion o...
A: According to the given question: Earlobes could be either free or attached. Free earlobe is the Domi...
Q: Explain why living things need to reproduce and discuss the types of reproduction
A: Reproduction is the process by which an independent individual is brought into existence by a preexi...
Q: Describe active transport, including cotransport.
A: Introduction :- The movement of molecules across a cell membrane from a lower concentration region t...
Q: This is not a graded question
A: Lactic acid fermentation is a form of metabolism that occurs when there is a lack of oxygen or when ...
Q: Discuss the possibility that tundra species could dodge the climate change bullet simply by adapting...
A: The tundra biome is characterised by its chilly and icy landscape. This biome has a brief growing se...
Q: 1. Construct a map for the genes d,e,f. Assume that: d and e = 3%; e and f = 5%. Give 2 arrangements...
A: Gene is the sequence of nucleotides in DNA which encode a particular protein.
Q: If you were asked to build a model of a nucleotide, what structures would you need to represent in t...
A: Introduction:- The hereditary ingredient in the cell is genetic material. It contains all of an orga...
Q: Which of the following exhibits Invoked Organization? * i. Regal Angelfish ii. Orb web spiders iii. ...
A: Although each living and non-living entity in the world appears to follow its unique pattern, a clos...
Q: Sofia has suffered a head injury and can no longer speak. However, after rehabiliation she recovers ...
A: MRI - magnetic resonance imaging is a medical imaging technique used in radiology to form picture of...
Q: Which of the following statements are true for root endodermis? I. Endodermal cells constitute the ...
A: Root endodermis is the inner boundary of cortex which is a single layer of cells outside the vascula...
Q: Describe the importance of Haworth and Fischer projections on sugars like pentoses and hexoses?
A: --Fischer projection is the 2D representation of an organic molecule by projection . This is mainly ...
Q: Which one of the following statements is not true? Speciation is the process of creating new spec...
A: A species is a group of organisms that have genetic similarities, may interbreed, and are hence fert...
Q: 2 3 4 5 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 ху Which chromosome set has an extra What diagn...
A: The first set has an extra chromosome. The patient suffers from aneuploidy. As the genome contains o...
Q: Please help me to graph this please please don't reject I have to do it now I am screwed if you reje...
A: The study and use of statistical approaches to a broad variety of problems in biology is known as bi...
Q: Enzymes Directions: Choose e color and color the pieces below. O Enzyme O Substrate O Active site O ...
A: Enzymes are biochemical catalysts that facilitate biochemical reactions. The enzymes are very specif...
Q: List out Bone loading bearing's material properties (
A: ✓Bone mineral is a ceramic material and exhibits normal Hookean elastic behaviour, i.e. a linear str...
Q: Complementary base pairing would involve: A. adenine bonded to cytosine. B. thymine bonded to aden...
A: In double-stranded nucleic acids such as DNA, the nitrogenous bases between the two strands are join...
Q: Which of the groups below is capable of only hydrophobic interactions?
A: In general, a molecule with more polar parts less non polar (hydrocarbon) part shows hydrophilic int...
Q: 72. Use Figure 2 to answer the following questions. (1.4) KU HOCH, OH H С — с H. ОН ОН ribose Figure...
A: The molecule given in diagram is Ribose It is a simple sugar and carbohydrate with molecular formula...
Q: Photosynthesis runs on the energy of_______ . a. light c. O2 b. hydrogen ions d. CO2
A: Introduction Plants need the green pigment chlorophyll to perform photosynthesis, which produces oxy...
Q: A person treated successfully by gene therapy will still have a defective copy of the gene. Explain ...
A: A gene is the fundamental structural and functional unit of heredity. Genes are comprised of DNA (de...
Q: Virology: What is a benefit of studying viral replication?
A: Viral replication refers to the process of copying of viral genome and its further assembly. Viruses...
Q: Consider the endomembrane system. Explain how a CFTR protein would be produced/synthesized in a lung...
A: CFTR ( cystic fibrosis Transmembrane receptor) protein is help in regulation of chloride and sodium ...
Q: an insect population lives on trees. over time, more trees with light colored bark grown in their ha...
A: Introduction:- Camouflage (noun) is defined as the act of concealing one's physical appearance. Camo...
Q: What are the three key features used to read chromosomes? Go to using karyptypes to predict genetic ...
A: Given: Chromosomes are long threadlike structure that is found inside the nucleus of cell. It is mad...
Q: Explain why you are for or against (a) raising theprice of water while providing lower lifeline rate...
A: Introduction Water is a molecule made up of two hydrogen atoms joined by a covalent link to the cent...
Q: TRUE OR FALSE
A: Puberty is the time when a boy or girl becomes sexually mature. It occurs between ages 10 and 14 for...
Q: Which parameter from the software must you adjust in order to permit gene flow? Starting frequency ...
A: Definition: Gene flow is the movement of gene from one organisms to another one. It can be in a hori...
Q: If a plant that is heterozygous for all theses characters is crossed with a plant homozygous dominan...
A: Mendel choses seven different traits " Pea shape round or wrinkled Pea color green or yellow Pod s...
Q: Dr. Krishna at CSU has been conducting research on snake venom. Similar to Dr. Krishna, a scientist ...
A: clusturing of species arises whether species coexist by partitioning resources, environmental prefe...
Q: QUESTION 35 You are conducting a QTL analysis to better understand monkey flower color and shap...
A: Introduction Heterozygous means that you have inherited different variants of a gene from each paren...
Q: A science teacher wants to test the effectiveness of two types of learning strategies. She uses a fl...
A: Introduction A language learning strategy refers to the processes and actions that language learners...
Q: Which is false about respiratory systems??  a. Usually the higher the metabolism, the more efficien...
A: The respiratory system is essentially a biological system in animals as well as plants that consists...
Q: Shaded in black-white trait (Glucose-6-phosphate dehydrogenase deficiency) 1. How many males are th...
A: Typically, at most one member of the family has a genetic condition, and analyzing the pedigree can ...
Q: QUESTION 12 Ack! Your nematode cultures are infested with a pesky, but novel bacterium! You decide t...
A: Speciation is the process through which one genetically related population splits into two populatio...
Q: Comparison to Human Arm in Form Comparison tó Human Arm Animal Function in Function vhale cat pat pi...
A: Homologous structures : These are the structures which are common in form but differ in function. Th...
Q: Label the butterfly lily/garland flower's stem structure. Use the photo given as a guide for your dr...
A: A butterfly lily is from genus Hedychium. It is used in Indian garlands often. Mostly white in colou...
Q: Explain the difference between a dehydration reaction and hydrolysis reaction.
A: Dehydration and hydrolysis are chemical reactions that are catalysed, or "accelerated," by enzymes. ...
Q: Explain what occurs during glycolysis, the Krebs (citric acid) cycle, and electron transport chain b...
A: GLYCOLYSIS : * It is an catabolic metabolic pathway which breakdown glucose into 2 molecules of pyr...
Q: PART I. THE THEORY OF EVOLUTION. DIRECTIONS: Complete the paragraph about evidence of evolution by c...
A: Introduction :- The theory of evolution is founded on the assumption that all species are connected ...
Q: The following experiment was set up to understand how catechol oxidase converts catechol oxidase cat...
A: Catechol Pyrocatechol or 1,2-dihydroxybenzene are other names for it. It is the ortho isomer of the...
Q: Describe one medical/ethical issue that was raised in your lifetime involving politics. How was poli...
A: In light of the recent pandemic that has created shockwaves globally, disruptions pertaining to the ...
Q: 3. Explain the term Refractive Index (n) of liquids, and describe how the values may be measured exp...
A: Refractive index It determines how much light is bent, or refracted when entering a material. When l...
Q: Explain what might happen in the food web if snakes were removed from the ecosystem Snake Frog Rabbi...
A: An ecosystem is defined as a structural and functional unit of ecology where plants, animals, and ot...
Q: A manne researcher wants to isolate the biIoactive compounds in a target manne organism. To be able ...
A: ANSWER) For the isolation of bioactive compounds in a target marine organism the researcher has to s...
Q: Make simple diagrams tracing the life history of Schistosoma japonicum
A: Schistosoma japonicum: Schistosoma japonicum is a significant parasite and one of the main schistos...
Q: Let's start with a little phylogeny! What features are at this node? The node is a branching point t...
A: Branch point or node shows the divergence of two species into respective descendants. All the descen...
Q: Standard of precautions provide guidelines for the purpose of; I. Eliminating the source of infectio...
A: Standard of precautions provide guidelines to prevent spreading of disease transmission (patient to ...
Q: What are three aspects of your lifestyle that mightdirectly or indirectly contribute to decline in E...
A: Honeybees and many other insects are natural pollinators of a large number of plant species.
Explain briefly the answer.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- Replicate the DNA strand AAGGCTAACGGCATTTAACCC. Transcribe the DNA strand AAGGCTAACGGCATTTAACCC. Translate your answer to #16 using the table below. Second letter A G UGU cys UGC UUU PheUCU UCC UCA UCG UAU1 UUC UUA UAC J Tyr Ser UAA Stop UGA Stop A UAG Stop UGG Trp G UUGLEU CAUTHIS CÁC CUU CUC CUA CUG CCU] CCC CCA CCG CGU] CGC Arg Leu Pro CAA GIn CGA CGG. CAGS ACU ACC ACA AAC FAsn AAA AGU Ser AGC AGA LArg Lys AGGJ AUU AAU AUC le A AUA The AUG Mer ACG AAGJ GAU ASP GACJ GUU GCU GCC GCA GCG GGU GGC Gly GUC Val GUA Ala GAAG Glu GAGJ GGA GUG GGG Third letter DUAG JCAG DUAG C. First letterComplete the complementary strand: DNA replication ATTCGAGGCTAAComplete the complementary stand of the DNA shown Complementary strand стАG GTACT CAC G
- Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will travel the furthest? BAM HI: GGATCC CCTAGG AATCGGATCCATTTGGACTAAAGGACCCGGATTGGATCCAGGGCCTTTAGTACC TTAGCCTAGGTAAACCTGATTTCCTGGGCCTAACCTAGGTCCCGGAAATCATGG O 3 O 2 4. 1.GENE H DNA CGCCCCTAT MRNA Amino AcidGIVEN: DNA CODING STRAND: GCG TAC TTT TCA GGT DNA TEMPLATE STRAND ____ ____ ____ ____