Step 1- The Synthesis of Dehydrozingerone from Vanillin Step 1 HO Vanillin H + KOH Acetone/H₂O Reflux ALDOL CONDENSATION HO fre Dehydrozingero ne (Vanillid enea ce to ne)
Q: Consider the E1 elimination products. Draw the minor product. Br Ꭰ H₂O
A: The major product is the Zaitsev product in which most substituted alkene is formed by eliminatin a…
Q: What volume of 5.00 × 10-3 M HNO3 is needed to titrate 80.00 mL of 5.00 × 10-3 M Ca(OH)2 to the…
A: Reaction involved is 2HNO3 + Ca(OH)2 -> Ca(NO3)2 + 2H2OAccording to reaction 1 mole of Ca(OH)2…
Q: For the aqueous [Hg14] complex K, -6.76 × 1029 at 25 °C. 2+ Suppose equal volumes of 0.0092 M Hg…
A:
Q: None
A: The pentapeptide in question is MGHFD, which stands for:- M: Methionine- G: Glycine- H: Histidine-…
Q: If a 25.0 mL sample of 1.50 M HCL solution were diluted 125-fold, what would be the volume and…
A: Given concentration of HCl (c)= 1.50 MConcentration of new HCl is 125 fold and it is diluted so new…
Q: Write two half-reactions to describe each of these metal displacement reactions. Include phase…
A:
Q: According to the chemists symbolic naming system, what is the name of this molecule? [13:1], A9…
A:
Q: Prepare the compound by using suitable reagents. More than one step will likely be required.
A:
Q: When two molecules collide, which requirements are necessary for a new product to be formed? Select…
A: Step 1: Conditions of collision theory are given below - (i) Molecules must collide with a…
Q: Mr. Gill is attempting to grow some new flowers at home. He knows that flowers and plants alike…
A: Le Chatelier's principle states that if a dynamic equilibrium is disturbed by changing the…
Q: Complete the electron configuration diagram below for a neutral Sb atom. 7p 6d 5f 7s 65 Increasing…
A: The atomic number of Sb = 51 ( reference:periodic table)Therefore,Number of…
Q: Please Write Step by Step Solution Otherwise I give DISLIKE !!
A: Thank you.
Q: Listen For the equilibrium system represented by 2C(g)+D(g) Elg), the equilibrium constant (Kc) is…
A: To calculate the final (equilibrium) concentrations of C and D, use ICE table to relate quantities…
Q: 3) A chemist tried the following reaction, but did not make the compound she expected. What did she…
A: Let's describe the workings of this surprising product:Mechanism:Formation of Bromonium Ion:Attack…
Q: Calculate the enthalpy of formation of benzene from the following data.2C6H6(g) + 15O2(g) --->…
A:
Q: A solution is prepared that is initially 0.25M in hypochlorous acid (HCIO) and 0.31M in potassium…
A: Step 1: GivenHypochlorous acid, [HClO] = 0.25 MPotassium hypochlorite, [KClO] = 0.31 MpH = ?Ka of…
Q: Name these organic compounds please:
A: All three structures above are alkanes. Alkanes are organic compounds that consist entirely of…
Q: The three normal modes of water are the symmetric stretch (3652 cm¹), the antisymmetric stretch…
A: Step 1: Step 2: Step 3: Step 4:
Q: (SYN) Show how to synthesize each of these alcohols from a ketone or aldehyde that has the same…
A:
Q: Water of Hydration Record the mass empty evaporating dish ( or crucible). Record the mass of dish…
A: Step 1: **Determine the mass of water lost** * Evaporating dish mass = 29.00 g. * The dish mass…
Q: Describe Auger/screw mechanisms and dosator mechanism by which capsules are produced. Use diagrams…
A: Auger/Screw Mechanisms:The auger or screw rotates at a controlled speed to draw the powder or…
Q: 24. Von Franz's work on alchemy focuses on: A) "The symbolic nature of alchemical texts and…
A: A) "The symbolic nature of alchemical texts and practices." is correct because:Marie-Louise von…
Q: = O Kinetics and Equilibrium 2/5 Bi Calculating an equilibrium constant from a heterogeneous…
A: Given: V=8.3Lmass,gMolarmass,g/mol2Hg(l)7.2200.59+O2(g)15.432.00→2HgO(s)11.7216.59Step 1:…
Q: Step-growth, or condensation, polymers are formed from monomers that have more than one functional…
A: Step 1: When hydrazine and oxalyl chloride react in the presence of hexane, they form a polyamide…
Q: Probide a synthetic pathway D O OH HH X
A:
Q: Constants Additional Materials Reading Submit Answer 5. [-/3 Points] DETAILS MY NOTES PREPCHEMCF1…
A: Step 1: Step 2: Step 3: Step 4:
Q: None
A: Here te aldehyde group is more electrophilic compared to the anhydride carbonyl. So the alkyl anion…
Q: Predict the product(s) for each reaction below
A: This are the products for the given reaction. Hope this helps, thank you!
Q: O O HO о 11 Br Н он да Product о Н
A:
Q: None
A: Step 1: Step 2: Step 3: Step 4:
Q: None
A: Part 2: Explanation:Step 1: The starting material, O-Ph (phenol ether), undergoes hydrolysis to…
Q: Calculate enthalpy of the reaction below using Hess' Law. 2CO(g) + O2(g) → 2CO2(g) 4H = ? C(s) +…
A: Step 1:
Q: Please answer the question for the reaction below: + A) B) D) 1) Base 2) 2-Pentenal 3) acidic water…
A: Detailed explanation:The reaction involves base, propenal, and acidic water. The starting aldehyde…
Q: a segment of dna has the following sequences of bases ATGCAATGATATTGAAGCTTA
A: The DNA segment you've provided, "ATGCAATGATATTGAAGCTTA," is composed of nucleotide bases. These…
Q: dont provide handwriting solution...
A: Step 1:The given question can be answered by using the Anti-Markovnikov rule or peroxide effect for…
Q: 2. Suggest two sets of conditions that would be needed to form the following cyclic ester (called a…
A: the mechanisms for the formation of tetrahydro-2H-pyran-2-one (lactone) from ethyl…
Q: What changes can be made to the hydrogenation reaction to make it safer for beginner students?
A: Based on the information which you have provided in question, which depicts a step in the transfer…
Q: how to synthesize this? b) NH2
A:
Q: A 25.0 g sample of quartz, which has a specific heat capacity of 0.730 Jgc, is dropped into an…
A:
Q: None
A: a)Step 1 adds nitro group to para position (methyl is an ortho, para director).Step 2 reduces nitro…
Q: 17. What is the Aldol addition product formed from reaction of the following compound with itself? О…
A:
Q: A bubble of methane gas, CH, is released from a deep bog. The temperature at the bottor the bog is…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: 1.3g of copper (II) chloride was dissolved in water and a 0.50g of Al was placed in the solution.…
A: Step 1:Given , Mass of (CuCl2) reacting= 1.3 g Mass of Al reacting = 0.50 g Actual yield of Cu…
Q: If I was in a rush and only let my TLC plate run 1 cm. Am I going to encounter anyissues? If so,…
A: IN SHORT, running a TLC plate for only 1 cm may result in incomplete separation, inaccurate Rf…
Q: H H 6. The relationship between the following structures are CH3 CH3 -OH HO- -H -OH H- -OH CH3 CH3
A: Thank you,Please rate y response.
Q: Give the major elimination product of the following reaction. (CH3)3COK CH3CH2Br ? heat OCH3CH2NH2…
A: Step 1:
Q: 1. Propose a synthesis of alkyl chloride A, using the following alcohol as a starting material.…
A: 1. You can do a substitution of an alcohol to a chlorine in a one step reaction using the reagents…
Q: Step 2 Add curved arrow(s) to draw step 2 of the mechanism. Modify the given drawing of the product…
A: ----------I m sure this will help you I hope you will appreciate my efforts Thank you!!!!!Happy…
Q: 18.3.2 Determining Reaction Orders Some useful physical properties: 1. Polarimetry (optical…
A: Dalton's law of partial pressure:Dalton's law of partial pressure states that total pressure of a…
Q: Give the structures of the cycloadducts formed -SO₂Ph + PhH t. amb. ➤ A + Ph CO₂Me + с CO₂Me Ph B
A: The image shows four sets of reactants undergoing cycloaddition reactions to form products labeled…
In the attached reaction experiment, dur the conversion of vanillin to dehydrozingerone multiple color changes occur. (colorless to yellow to deep red back to yellow) Explain what causes these color shifts. Be sure to include the appropriate chemical structures as part of your answer.
Step by step
Solved in 2 steps
- OH - NH, Br2/KOH →product; 1. (a-hydroxy amide) Product of this Hoffmann bromamide reaction is : OH (a) Ph – Ĉ-CH3 (Ъ) Ph — CHO (c) Ph- CH3 (d) Ph – CH2 -NH2 NO24) Propose a pathway to synthesize 2-Methylpentane using: + 2li + CUI + CH3CH2CM2Č!:Identify the major prouct of the folowing sololvsi reaction of 3bromo-1-methyiycopentene with methanol, Br CH,OH to
- (c) With reference to the following reaction scheme: Met N Me Boc 20 OMe DIBAL, toluene, -78 °C then H₂O w/up Me+N Mé Boc 21 H Useful structure: DIBAL= H₂ Al Y Bary (i) Provide a curved arrow mechanism for the reduction of ester 20 to aldehyde 21. (ii) Explain why the reduction of ester 20 selectively affords aldehyde 21 in the presence of DIBAL, whereas treatment of 20 with LiAlH4 leads to over-reduction.Q2/Suggest a mechanism and give name reaction for each the following reactions: 1) acetic anhydride + benzaldehyde 1) CH₂COO 2) H₂O cinnamic acid 3) H₂O/H* 2) diethylcarbonate + ethylacetate 1) CH3CH₂O diethylmalonate 2) H+which of the following is the correct mechanism for the acid-catalyzed conversion of a keto to enol isomer? A B C D :: :O: H+ H+ 一 :0: In :ÖH :: :ÖH 另一面一卡一工.. H + H H H H H+ :ÖH 犬一一次。 H+ :ÖH 加一一 H+ :ÖH :0 :ÖH H+ :ÖH
- CH3 NH3, H* H3C H3C CH: Substituted pyrroles are often prepared by treatment of a 1,4-diketone with ammonia in the presence of catalytic H*. The mechanism involves the following steps: 1) Protonation of the carbonyl oxygen and nucleophilic attack by ammonia form tetrahedral intermediate 1; 2) Proton transfer leads to protonated carbinolamine 2; 3) B-elimination leads to enamine 3; 4) Protonation of the carbonyl oxygen and nucleophilic attack by the amine form tetrahedral intermediate 4; 5) Proton transfer leads to protonated carbinolamine 5; 6) B-elimination leads to the final product. Write out the reaction mechanism on a separate sheet of paper, and then draw the structure of tetrahedral intermediate 4. • You do not have to consider stereochemistry. You do not have to explicitly draw H atoms. Do not include lone pairs in your answer. ZISynthesize 48 assume that the followine also aveilable are acetoacetic ester malonic cstes NHCH3A molecule of propanone reacts with an cyclohexylethanone in presence of aq. NaOH to combine together, and the resulting product is boiled to produce another product, (i) CH3 -NH2 НО H;CO
- The following presented reaction scheme lead to the synthesis of which major product from benzene assuming separation of products is possible? 1 NaOH CI. Product Product HSO 2 H,0 FeCl OA Meta-Chlorophenol U& para-ChloroSulfenic acid 6C Para-Chlorophenol 0O Mela chioroaniline3) Show how you would synthesize the following Compounds, storting with benzene or toluene ond ASSume any necessory pro duct (ond seperoble from ortho) in ortho, pora reogents, poro is the mogor mixture c)o- chlorobenzoic ocid d) m- chloronitro benzeneWhich of the following will be the dominant product of the dehydration reaction shown? H;PO, H2O. A но (A) (B) (C) (D) Compound B Compound C OCompoundD OCompound A nintc)