The answer above was what I was looking, but none other question I submitted gave me numerous answers not even pertaining to the question I submitted. When sending a question I want the answer to the question that was sent.

Q: The tertiary structure of gp120 is shown below. Please describe the protein (make sure to cover…

A: The primary structure of gp120 is the sequence of amino acids that make up the protein. This…

Q: A protein is a glycoprotein and it is active when it is glycosylated. The gene of this protein was…

A: Glycosylation is a process by which carbohydrates are added to proteins. This process typically…

Q: Which amino acids would you expect to find marked on the alpha helix? Alanine Isoleucine Leucine…

A: A prevalent motif in the secondary structure of proteins, the alpha helix (-helix) is a right-hand…

Q: form a phylogentic tree with the following clades: Anaspida…

A: Vertebrata (Crown) / \ Gnathostomata Placodermi / \ / Chondrichthyes Osteichthyes…

Q: What should be the appropriate oxygen gradient for an algae to grow in an bottle culture (water…

A: The process of photosynthesis allows the algae, like other plants containing chlorophyll, to…

Q: 1. What does medical microbiology study? How are aniline dye solutions prepared? How to calculate…

A: Microscopy is an essential tool for biologists to observe and study the structure, function,…

Q: There is a non-harmful species of fly that has a body coloration pattern that is similar to bees and…

A: It's important to note that mimicry is not always a perfect adaptation, and there are many factors…

Q: Sickle cell anemia is caused by a point mutation in the β-globin chain of hemoglobin. Glutamic acid…

A: Introduction : Haemoglobin is a tetrameric proteinmade up of 2 alpha subunits and 2 beta subunits…

Q: ACTIVITY 6 1. Taste is sensed by receptors called. 2. Name the four main tastes. 1. 2. 1. 2. 3. 3.…

A: ANSWER)  The perception of taste is received when the chemicals in the edible products gets…

Q: Match the experiment to the key learning Rice has 51 000 protein- coding genes, but humans have…

A: The C-value paradox, also known as the C-value enigma, is the observation that the total amount of…

Q: b Rewrite his hypothe: C After Spallanzani ca

A: a. Spallanzani hypothesized that bats are able to fly in the dark without bumping anywhere as they…

Q: 1. ___ , including mast cells, eosinophils, basophils, and ___ , respond to multiple extracellular…

A: When the immune system is weakened or compromised, it is less effective at protecting the body, and…

Q: Allan Pounds and Kevin Anchukaitis both think only one factor - either climate change or an El Nino…

A: Golden toads were found in the Costa Rican rainforests. The male frogs had striking orange color,…

Q: Define the term 'oedema' and in your response show your understanding how liver disease can…

A: Oedema is defined as it is abnormal accumulation of watery fluid in the serous cavity or…

Q: What are the different levels of organization in living organisms, from cells to ecosystems?

A: The systematic organization of organisms into different levels is called biological hierarchy. It is…

Q: Why is it important for healthcare professionals in the United States maintaining current knowledge…

A: An outbreak is a rapid increase in the number of cases of a disease within a particular area or…

Q: Suppose you are handling a P 200-1000 µl micropipette and while adjusting the volume you go over the…

A: Micropipette is an instrument used to measure volumes in microliters in the laboratory. The art of…

Q: Translate and transcribe the following DNA molecules DNA:AATACGGGGGCGTAACCACTA mRNA: amino acids:

A: DNA is a molecule that carries genetic information. It contains instructions used in the growth,…

Q: A region where the temperature changes sharply on a short distance is called: 00 A temperature…

A: A temperature front is a region where two different air masses meet at the surface of the Earth. The…

Q: . Compared to innate immunity, adaptive immunity (A) has a response time of minutes to hours. (B)…

A: Our immune response protects us from the different pathogens and allergens. When an antigen…

Q: Using function as the discriminating feature, draw up a dichotomous key to distinguish the 4 cells…

A: A dichotomous key for immune cells is a tool for identifying and classifying various types of immune…

Q: Duroc Jersey pigs are typically red, but a sandy variation is also seen. When two different…

A: The pattern of inheritance seen in Duroc Jersey pigs is an example of Mendelian genetics, which…

Q: If the body does not respond to insulin (insulin resistance), it would lead to:   a.…

A: ANSWER: The correct option is: b. hyperglycemia.

Q: Mutation that results in death before the age of reproduction Mutation that results in an inactive…

A: Dominant mutations are those mutations which arise from the mutation of single copy of  dominant…

Q: Can the gram stain be observed using a form of microscopy other than light microscopy? Why or why…

A: The Gram stain is a common laboratory procedure used to identify and differentiate bacteria into two…

Q: A botanist is studying the phylogenetic relationships of plants using only their their morphological…

A: Phylogenetic analysis is a method for studying the evolutionary relationships between various…

Q: 16. Which of the following statements about fetal breathing is TRUE? It_ O is only exhibited by some…

A: Zygote is produced by the fusion of male gamete (sperm) and female gamete (egg). This process is…

Q: DNA is comprised of four different bases. What are the four different bases? What is so significant…

A: Introduction : The full form of DNA is deoxyribose nucleic acid. It carries genetic information from…

Q: Part B Can you match these prefixes, suffixes, and word roots with their definitions? endo- chloro-…

A: There are many words in science terminology which are derived from different origins. The common…

Q: “DNMT3L Connects Unmethylated Lysine 4 of Histone H3 to de novo Methylation of DNA,” the authors…

A: Figure a and b of the paper “DNMT3L Connects Unmethylated Lysine 4 of Histone H3 to de novo…

Q: ou are designing a medical device to collect Carcinoembryonic Antigen (CA, MW = 180,000 g mol^-1), a…

A: A) Diffusivity of CEA within the extraction chamber (D): D = kT/(6πηr) k = Boltzmann constant = 1.38…

Q: beavers build dom in a stream

A: Beavers These are large, semiaquatic rodents found in the Northern Hemisphere. These are the second…

Q: In a Gram-stained smear, medium-sized rods with rounded, pink ends were found, arranged chaotically.…

A: The Gram stain is a widely used method for differentiating between different types of bacteria. The…

Q: How are drugs actually selective to prokaryotes and not eukaryotes? Think of metabolisms differences…

A: Prokaryotes are the cells which lack membrane bound nucleus,membrane bound cell organelles for…

Q: Explain how the advancements in modern technology influence the performance of today's medical…

A: The advancement and innovation in modern technologies provide huge benefits for clinical trials and…

Q: 3. The Canadian Lynx in Northern Canada depends on snowshoe hares for food. Explain the…

A: Predator-prey cycles are based on a feeding connection between two species: as the prey species…

Q: A cell undergoing division has a haploid chromosome number of 15. Give the numerical value for each…

A: Since you have asked multiple sub parts, we will solve first three sub parts for you. If you want…

Q: . True or False: Alpha cells secrete glucagon, which causes cells to release stored glucose into the…

A: Alpha cells, located in the pancreas, are an important part of the body's endocrine system. They…

Q: Briefly describe the short term regulation of blood pressure and relate the failure of these…

A: Short-term regulation of blood pressure is controlled by the autonomic nervous system. Blood…

Q: DNA Nano measurements: width of the helix, spacing between nucleotides Use the functional groups…

A: My synthetic nucleotide would have a thymine base connected to a deoxyribose sugar and a phosphate…

Q: How many genes are there in human sperm cells? A. 23 B.46 C.5,000-10,000 D.About 23000 E.About…

A: INTRODUCTION A human sperm cell is a reproductive cell produced in the testes of males which is…

Q: plant species has flowers that can be red, pink, or white. Flower color is controlled by one gene…

A: According to Hardy Weinberg equation p2 + q2 +2pq =1 and p +q =1 Where  p= frequency of the dominant…

Q: b) Relate how the predator-prey cycle is a form of density-dependent population control.

A: ANSWER: Because of the inverse link that exists between the populations of predators and their prey,…

Q: You are studying a biochemical pathway that requires ATP as an energy source. To your dismay, the…

A: ATP is used as the energy currency of the cell. It is mainly produced by the aerobic cellular…

Q: Connective Tissue: Cell Types: (Short Answer Questions) Describe the three (3) types of cells and…

A: Since you've asked multiple questions, we're only answering the first three for you, if you want any…

Q: Define primary (essential) hypertension. Identify and briefly explain three modifiable risk factors…

A: Comprehensive physical, mental, and social well-being is a condition of being in good health. It…

Q: which events occurs at A, B, and C ? choose the answers above: - cytokines are released…

A: The immune response is the body's defence against foreign substances like viruses and bacteria. It…

Q: For urinary portal of exit, do all parasites live within the kidney, ureter or bladder? Explain.

A: The urinary portal of exit is the area that connects the organs involved in urine production and…

Q: an intravenous infusion of 200 mg of an antibiotic was given for 30 minutes. After stopping the…

A: The quantity of solute in a solution can be expressed in a variety of ways. The amount of solute…

Q: During a one-year period, a population of rabbits has a birth rate of 0.8 and a death rate of 0.1.…

A: The change in a population is governed by the number of births and deaths. If the birth rate is…