The following protein sequence was made. N-MET TYR GLN GLN CYS-C a. Using the top most option from the genetic code table write the mRNA sequence for this protein indicating 5' and 3'.
Q: 9/26/22, 1:40 11 What is the name of the body cavity that holds the internal organs of highe…
A: Septum It is a wall, dividing a cavity or structure into smaller ones. Coelom Body cavity filled…
Q: BOTANY The placentation type is often retained when the ovary matures into a fruit. Is it possible…
A: The arrangement of placenta called as placentation. The function of placentation is to transfer…
Q: Initiation. Promotion Progression/ Angiogenesis, tumor migtation Cells multiply uncontrollably DNA…
A: Cancer is defined as rapid non-controllable cell division triggered by either external (UV or…
Q: About _____% of the variance between physical activity levels in humans is due to genetic variation.…
A: Taking care of fitness immediately allows us to be productive and provides us stamina and…
Q: what is bone marrow as an hematopoietic organ
A: Mesenchymal and hematopoietic stem cells are found in bone marrow. Red bone marrow is a fragile,…
Q: Which of these processes are catalyzed by ribozymes? (Select all that apply.) DNA synthesis…
A: A ribozyme is defined as a ribonucleic acid enzyme that is required to catalyse a chemical reaction.…
Q: Describe the fluid compartments (ICF, ECF, blood and interstitial fluid) Describe the distribution…
A:
Q: How is potassium important to the sodium pump a) attracts sodium out of the protein pump surface. b)…
A: Introduction Potassium pump:- This pump is found in cell membrane. ATP is needed for this pump to…
Q: Classify lipid with examples ..
A: Lipids are a heterogeneous class of organic compounds that are fatty acids or there derivatives and…
Q: Answer the following questions: 1. What is the importance of capsule to a microoganism? 2. Why is…
A: Capsules are the outmost structures of bacterial and fungal cells.
Q: The incoming vesicle is responsible for O a) bringing substances into the cell b) synthesizing…
A: Vesicles are small cell organelles that are present in cells. These organelles are small,…
Q: -Which drawing of the intertidal region correctly represents Chthamalus' fundamental niche with an…
A: Every species finds their own niche according to their feeding habits, living conditions, favourable…
Q: . Explain the cell theory
A: In 1665, Robert Hooke became the first scientist to identify the cell. Hooke observed a swarm of…
Q: What evidences supported spontaneous generation? How was spontaneous generation disproved?
A: Introduction The scientific idea of spontaneous generation, which has since been disproved, claimed…
Q: O Biological O Phenetic O Phylogenetic O Parasympathetic 200 A-beaver Dam, AZ B-Twentynine Palms, CA…
A: Introduction Classification means the arrangement of various species into a groups. In the world…
Q: Upper Intertidal Zone Lower Intertidal Zone Balonus kalenvides Chthamalus scellatus The diagram…
A: Introduction: Connell is an American ecologist, but because his research on how interspecific…
Q: After lipids are digested and enter absorptive cells, identify which lipids enter capillaries…
A: Biomolecules called lipids can only dissolve in nonpolar liquids. The term "non-polar solvent"…
Q: + 머 B D C F E -40-4040 | 1602 ㅁㅅㅁ 거머가 40000 I ㅁㅁㅁ ㅅㅁㅅㅁㅅㅁ
A: Introduction: Autoimmunity is a situation in which the attack on one's own antigen by…
Q: Is there any form of matter or energy that could never be considered pollution? Briefly compare and…
A: Our modern lifestyle renders us more susceptible to many illnesses. With increased pollution and bad…
Q: Identify the type of division exhibited by the following: Binary fission Grasses Hydra Budding…
A: Reproduction The process of producing offspring. Reproduction make sure the life continues on earth.
Q: This type of cell transport happens during secretion of hormones, neurotransmitters and digestive…
A: Introduction: Substances travel through the cell membrane during cell transports.The cells allow the…
Q: Describe the fluid properties of the cell membrane and explain how membrane fluidity is influenced…
A: Introduction: The cell membrane performs a variety of tasks, including ion conductivity, cell…
Q: The _____________ plants died, partially decomposed, and became the fossil fuels? (choose all that…
A: Sphagnum Moss: There are over 380 recognised species of mosses in the genus Sphagnum, which is also…
Q: Calculate ΔGinward. Is energy required for transport to happen? The cell is at 25°C. Membrane…
A: Energy is required in cases where there is active transport of molecules as molecules are…
Q: Molecule X is expected to be a non-competitive inhibitor of an enzyme. If the inhibitor was tested…
A: Vmax of a reaction is the maximum velocity of the enzyme that carries out the reaction that is when…
Q: (N + N) 2N N Match the correct stage to the correct ploidy 1. Sporophyte 2. Gametophyte 3.…
A: Introduction PLOIDY:- It is a total number of chromosome sets in somatic cells of the diploid phase…
Q: How will the color change of the bromothymol blue solution be affected by exercise? Be sure to…
A: Bromthymol Blue is a dye used as an indicator in determining pH. Bromthymol blue is a weak acid. It…
Q: Enzyme activity is an important characteristic of enzymes, and its units are moles (M) or milimoles…
A: 2. When substrate concentration ranged from 0 to 20 mM the enzyme activity surged exponentially from…
Q: This week you learned about the role that macrophages, neutrophils, and cytokines play in the innate…
A: Microbial infections are frequently treated with antibiotics. It is getting harder and harder to…
Q: Which of the following is O They are multi-cellular O They exchange genetic O They are eukaryotic. O…
A: Introduction Microbes are microscopic, single cells that are completely invisible to the human eye.…
Q: How does the ankle joint change in structure and function among salamanders, lizards, mammals
A: The ankle joint is also known as the talocrural joint is a synovial joint located in the lower limb.…
Q: One study predicted that trained subjects would have a resting metabolic rate 100-200 kcal/day…
A: The energy spent when a body performs basic functions which are required to stay alive is basal…
Q: What is the purpose of control tubes in an experiment? a. To use up more tubes and look more…
A: The unknown sample is tested and compared to positive and negative controls to determine the test…
Q: Reason why capsule is very important to microorganism?
A: Capsules are the outmost structures of bacterial and fungal cells. It is a polysaccharide layer that…
Q: Where in the body does most digestion occur? a. mouth b. stomach c. small intestine d. large…
A: Digestion is the complex process of converting the food you eat into nutrients that your body can…
Q: A scuba diver at an evenly lit depth thought the surface of the water was over his head. How did he…
A: The cerebellum, the part of the brain which controls movement, receives data on the position of the…
Q: This type of cell transport happens during secretion of hormones, neurotransmitters and digestive…
A: Introduction Cell transports are the movement of a material through the cell membrane. The chemical…
Q: Redraw and rearrange the branches of the tree below to make the most parsimonious (simplest) tree. A…
A:
Q: Explain cell theory in three sentences.
A: Introduction : A cell is the basic structural and fundamental unit of life. Cells are the building…
Q: AaBBdd x AaBbDd punnet square genotype phenotype
A: Introduction A Punnett square is a pictorial depiction of the genetic variants that could be…
Q: The following is a purine: a. Adenine b. Guanine c. Thymine d. A and B e. All of the Above
A: Purines and pyrimidines are both organic compounds that take part in the synthesis of DNA and RNA.
Q: Many obese patients are part of a family in which all, or the majority, of it's members are obese.…
A: Genes are information/ trait encoding units present in the genome or DNA of organisms. These genes…
Q: How is the DNA unwound at the replication fork? What effect does this have on the DNA upstream of…
A: DNA It is a double stranded helical structure present in almost all eukaryotic cell.
Q: What is the purpose of the following substances in the dna extraction procedure: Detergent…
A: DNA extraction The process of removal of dna molecule from inside the cell.
Q: Use the graphs below to answer the following 5 questions. Biomass Time The growth of Lemna polyrhiza…
A: Intraspecific competition The competition between two same species is know as intraspecific…
Q: Why is there a need to provide the magnification of a specimen drawn
A: Microscopy is used to visualise the objects such as tissues, cells, nanoparticles etc. which can not…
Q: Which of the following occurs when red blood cells are transferred from an isotonic solution to a…
A: Many biological subdisciplines exist within cell biology. An illustration of this would be studying…
Q: The following are the conditions that determines the direction of ions as it pass through the…
A: Introduction : A membrane that permits certain molecules to pass through it but not others is said…
Q: Which of the following statements is NOT TRUE about membrane transport? to facilitate movement of…
A: The cell is the primary and fundamental unit of life and each living organism is made up of a cell…
Q: Translate the mRNA into a protein using the genetic code. (Amino acid chain.) AUG( met)-UUU(…
A: Introduction The genetic code is a set of instructions that enable live cells to produce proteins…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.From the mRNA base sequence CUU-AUG-GCU-UGG-CCC-UAA A.What anticodon sequences of tRNA’s are coded? B.What was the base sequence in the original DNA strand was made? Please answer completely will give rating surely Both questions answers needed
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GThe DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter GlyThe sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.
- 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'. 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a T, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutation 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a A, then the result will be A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutationFirst Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a post transcriptional processing Once the transcript is made, do the process of translation. Again follow the steps. Use the Wobble Table for reference 5’ CTATATTTATGTGCTATATCCAGGACTGCCCCTAGGAAATAAAAAA…AAAAAAA 3’3’ GATATAAATACACGATATAGGTCCTGACGGGGATCCTTTATTTTTT…TTTTTTT 5’
- The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINY5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'.Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…