The translation of an mRNA begins with the codon AUG, and an initiator tRNA is required to start translation. List the mechanistic steps in eukaryotes that allow the initiator tRNA to begin searching for the start codon.
Q: Describe how Balantidium coli invades the tissue. How is it different from invasion by Entamoeba…
A: Parasitic infections are found all around the globe and various diagnostic techniques have been…
Q: Statement 1: Major histocompatibility complex proteins help the immune system recognize 'self' vs…
A: An organism's immune system is a set of biological systems that protect it from disease. It can…
Q: List five proteins that interact with the CFTR protein.
A: Proteins that interact with CFTR protein.
Q: In the context of the cell cycle, which cyclin is most important for the G1 to S transition, the G2…
A: Cyclins are a group of proteins that regulates the cell cycle progression. Cyclins function by…
Q: Summarize the two steps below AND indicate the specific location within a cell where each.…
A: DNA DNA is a long polynucleotide chain containing information about polypeptide chain.
Q: Two inbred lines of beans are intercrossed. In the F1, the variance in the bean weight is measured…
A: Broad-sense heritability is the ratio of genotypic variance VG to the total phenotypic variance VP.…
Q: Identify the Lewis acid in the following reaction: A. BF3 B. F C. BF4 D. None of these is an acid.…
A: Boron trifluoride (BF3) is a Lewis acid because it is an electron-deficient molecule that may take…
Q: 5'-AAGCGGGTGTGAGGAGCGCGGCAGCTCAGGTACCCCCGGCCAGGCGCG-3' 31-TTCGCCCACACTCCTCGCGCCGT…
A:
Q: Plate count method assumes that a colony arise from one cell. Some species grow in clusters and this…
A: Plate count method assumes that a colony arise from one cell. Explanation: Plate counting is…
Q: B. Identify the type of respiration in the following animals. Organism Cockroaches Bacteria…
A: Respiration A metabolic process wherein, the living cells of an organism obtains energy (in the form…
Q: The pinniped hookworm (Uncinaria lucasi) life cycle that you learned previously involves which types…
A: Uncinaria lucasi It is commonly called the hookworm, and it completes its life cycle in the fur…
Q: The biological differences in sex can be seen in genitals, reproductive organs, hormones and…
A: Introduction The two sexes are differentiated as male and females; males who have testes and produce…
Q: How does primary and tertiary structure influence the function of uniprotkb-p39086?
A: There are few important points : Proteins are unbranched polymers constructed from 22 standard alpha…
Q: 7. Which of the following statements is/are true? I. Pistil is a male reproductive part of plants…
A: There are four distinct wholrs of flower - Calyx Corolla Androecium Gynoecium
Q: Give the respective structural descriptions and functions of the following: 1. Cell Membrane 2.…
A: Cell is an elemental unit of the body in which numerous metabolic activities are performed . Cell…
Q: Illustrate how cohesin proteins form a V-shape heterodimer.
A:
Q: Briefly describe the causes and initial pathophysiology of diabetes type II.
A: Introduction Diabetes type II:- It is an impairment in the way the body regulates and uses sugar…
Q: 25) In muscle contraction cycles, bridge during which myosin; actin; ATP; energy actin; myosin; ATP;…
A: The skeleton muscle is the classic example of interaction between actin filament and myosin…
Q: In 1985, a 0.5-mm cell was discovered in surgeonfish and named Epulopiscium fishelsoni. It was…
A: Introduction Protozoa are microscopic unicellular eukaryotes with a complex internal structure and a…
Q: If the AMP was mistakenly left out of the LB/AMP/X-gal/IPTG agar media E. coli cells transformed…
A: *NOTE: Kindly repost for other question Dear Student as per the guidelines we are supposed to answer…
Q: 5.How does the simulation model natural selection?
A: Introduction Evolution is the change of biological populations' heritable features across…
Q: If you want to decrease gene expression, you would need the activity of which RNA? O mRNA miRNA O…
A: RNA interference It is a mechanism that inhibits gene expression at the stage of translation or by…
Q: What molecule is produced by the chemical packet in the anaerobe jar that is responsible for…
A: Introduction The existence of free oxygen (O2) distinguishes an aerobic environment from an…
Q: Hypothyroidism during pregnancy causes some defects in growing babies. State any two of them.
A: Answer : hypothyroidism during pregnancy causes some defects in growing babies they are : 1)…
Q: Distinguish the Morphological Characteristics of these Animal Tissues: 1. Ciliated 2. Areolar 3.…
A: Introduction Tissue is a collection of cells with similar structures that work together as a unit.…
Q: CASE STUDY 15.4 A disoriented 58-year-old man with a history of poorly controlled diabetes…
A: Introduction Infections that occur more frequently or are more severe in persons with impaired…
Q: Explain the main theme of evolution: “unity in diversity”.
A: Earth is Inhabited by tremendous variety of life. More than 1 million species have been discovered…
Q: What is cell cycle what is dna and its functions give 3 reasons why cell needs to undergo cell…
A: 1) Cell cycle It is a series of events that a cell passes through from the time until it…
Q: P generation Parent 1 Parent 2 X Using a separate piece of paper, draw out a Punnett square, and…
A: A trait is a characteristic feature that is unique to particular individual . A monohybrid cross is…
Q: I. Three types of muscle fibres are identified: I, Ila and IIx. 11. Type I is less resistant to…
A: answer is i, iii and iv.
Q: What is the function of nerve tissue?
A: The word "nervous tissue" refers to clusters of organised cells in the nervous system, which is the…
Q: which reasons do the Prarie chicken and snake weed grasshopper population grow
A: Population growth It is a parameter that defines the increase in several organisms (for which the…
Q: A. Explain how respiration takes place in plants in: Roots Leaves Stem
A: Respiration takes place in roots- Roots, the underground part of the plants, absorbs air from the…
Q: Which of the following base change in the sense strand will result in the alteration of the net…
A: Option (A) TCT codes for - Serine (Polar, but Uncharged) TTA codes for - Phenylalanine (Non polar)…
Q: Naked viruses typically exit the cell via this/these processes (may choose more than one). a.…
A: Naked viruses are generally thought to leave cells by causing rupture of the infected cells, leading…
Q: Nematode Ascaris lumbricoides Trichuris trichiura Strongyloides stercoralis Necator americanus…
A: *Life cycle of trematodes usually have two hosts where they can paratise . * One is definitive host…
Q: : of anaphylactic reaction is the epinephrine The treatment of anaphylactic reaction is the…
A: Intramuscular injection means into the muscle.
Q: In acid fast staining, lipoidal material of acid fast cells absorbs the methylene blue. Upon the…
A:
Q: Describe the following pathogenic bacteria: Bacterium 1. Bacillus anthracis 2. Escherichia coli 3.…
A: Bacterium Staining Reaction Morphology Disease(s) 1. B. anthracis Gram staining: positive, large…
Q: yyyy W A В C D If the figure above represents two different species phylogenies, one with the black…
A: Species diversity is a term that describes a broad range of organisms living in a given ecosystem.…
Q: Rabies is a viral zoonosis that is transmitted directly from the bite of an infected animal. The…
A: Rabies vaccines may be produced in human diploid cells, in continuous cell lines, in primary hamster…
Q: L3 1) Given 1 initial layer (L1), what pattern of division led to L2? 2) If this specimen was an…
A: 1) L1 Division and Differentiation Patterns Influence Shoot Apical Meristem Maintenance, Upper two…
Q: 17) Under aerobic metabolism, and produce ATP for which the process is carried out inside the water;…
A: Introduction:- The human body uses glucose to make adenosine triphosphate (ATP) molecules during the…
Q: rase, movement during mitosis and meiosis? Explain. omosome ay
A: Cohesin is the protein which is responsible for the sister chromatids to remain close to each other…
Q: Match the following concepts with the definitions listed below them.____ a. diffusion____ b.…
A: DIFFUSION is the social process that occurs when members of one group borrow social and cultural…
Q: When the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were…
A: Answer :: If the dCTP was not present, the polymerization would come to a standstill, resulting…
Q: Statement 1: Antibodies are not specific for each type of antigen encountered by the body. Statement…
A: Introduction The immune system defends our bodies against foreign pathogens. These include bacteria,…
Q: Discuss the adaptations that plants and protists have evolved to invade and manipulate their hosts.…
A: Introduction A biological defense mechanism is a form of adaptation that promote the survivability…
Q: which of the following is the outgroup?
A: The phylogenytic tree gives us idea about the relationship between different organisms based on…
Q: profile-image For which organism and life stage would you expect to see the most rapid senescence?…
A: Introduction The slow decline of functional characteristics of living organisms is known as…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAi Met were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. a. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning. b. If the same experiment had been conducted on bacterial cells, what results would you expect? c. Explain why some of the proteins produced contained extra amino acids while others contained fewer amino acids than normal
- Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAiMet were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. Q. If the same experiment had been conducted on bacterial cells, what results would you expect?Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAiMet were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. Q. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning.Refer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codon
- The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a diff erent C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAiMet were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra aminoacids, and others contained fewer amino acids than normal. a. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning. b. If the same experiment had been conducted on bacterial cells, what results would you expect? c. Explain why some of the proteins produced contained extra amino acids while others contained fewer amino acids than normal.An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’
- Below is a diagram of charged tRNAS in the active site of the ribosome during translation of the MRNA into protein. What would be the codon in the mRNA that base pairs with the anti-codon in the t- RNA charged with Glu (Glutamic acid) ? HINT: Check the genetic code table/chart. X. Ala Arg Cys Gly Met Trp Leu Glu TRNA B TRNA A A 5'-AAC-3' 5'-CUU-3' 5'-GAA-3' 5'-AUG-3'Translation is the process by which the sets of 3 bases (codons) of the mRNA are read to specify the sequence of amino acids for the protein to be produced. Using the genetic code data provided, find the sequence of amino acids that would correspond to the MRNA codons shown. Codons 1 3 MRNA A UGUGGAUC CGAG UCACG Amino acid SECOND LETTER A U UUU Phenylalanine UCU UCC Serine (S) UAU Tyrosine (Y) UAC TAA stop codon UAG stop codon UGU Cysteine (C) UGC TỮA Leucine (L) TGA stop codon UGG Tryptophan (W) F UCA UUG UCG I H CUU CCU CAU Histidine (H) R CGU CỨC Leucine (L) CỦA CCC Proline (P) ССА CCG CGC Arginine (R) CGA CAC "CAA Glutamine CAG (Q CUG CGG G D A AUU L AUC Isoleucine (1) AAU Asparagine AAC (N) ÄÄÄ Lysine (K) AGU Senine (S) ACU ACC Threonine ACA (T) AGC E AUA AGA Arginine (R) E ACG T AUG stat codon (M) AAG AGG TG GƯỮ GAU Apartic acid GAC (D) "GAÄ Glutamic acid GCU GGU GUC Valine (V) GUA GGC Glycine (0) GCC Alanine (A) CE GCA GGA R GUG GCG GGG GAG (E) The start codonencodes the amino…Consider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-GCAAGUCUUAAU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. ala-ser-leu-asn 2. If mutation occurs by substitution of the 6th nucleotide with adenosine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.
