Q: what is your opinion on Genetic Engineering? Support your opinion with facts and include the issue…
A: Genetic engineering: Genetic engineering is the process of altering an organism's genetic makeup…
Q: BCL2 binds to and inactivates BAX and other pro-apoptotic proteins, thereby inhibiting apoptosis.…
A: Chronic lymphocytic leukaemia is a malignancy in which the bone marrow produces an excessive number…
Q: Which of the following is not a possible outcome of changing the epigenetic code? a) exposure of…
A: * Epigenetic code is an defining code in eukaryotic cells in which each cell consist specific…
Q: chromosome of genotype C D recombines with a homolog of genotype c d during meiosis when Spo11…
A: * Given that chromosome of genotype "CD" recombines with a homologous of genotype "cd" during…
Q: Because a specific nutrient is enriched in a supplement, it is absorbed better than it is from the…
A: Supplements aren't meant to take the place of eating. They can't duplicate all of the nutrition and…
Q: Using the data below from a batch test, estimate the observed yield and the decay rate of an…
A: Toluene is used in a variety of occupational settings. It is a solvent for paints and glues and is…
Q: Use the pedigree to answer the question: Ge the genotype and gender of Individual R in generation…
A: Pedigree It is a genetic representation of family tree.
Q: Which disease is caused by the deficient of vitamin B,? (A) Measles (B) Mumps (C) Beriberi (D)…
A: The correct option is C - BERIBERI
Q: Now, DEC wants to change this harvest quota to maintain a stable fisher population for the next…
A: Scientific tendencies of the remaining 50 years have led to miles stepped forward expertise of the…
Q: TNF-alpha treatment of prostate carcinoma, LNCAP cells decreases cell survival as shown in the graph…
A: * TNF inhibitors are the drugs helps to prevent inflammation to grow which are used to to treat…
Q: Many animals and plants bear recessive alleles for albinism, a condition in which homozygous…
A: Genotype : A genotype is a individual's collection of genes. The genotype is expressed when the…
Q: Choose the wrong, gel-like solution in the mitochondria countians: Select one: О a. АТР enzymes…
A: Among most eukaryotic species, a mitochondrion is an organelle which has double-membrane.…
Q: A regulatory region shows all of the following properties except
A: Ans - a) can be located in an exon. Regulatory regions cannot be present at the exon portion of a…
Q: Pedigree 2: A. What is the most likely mode of inheritance of this disease? Choose from: autosomal…
A: Pedigree analysis is a family chart representing the person's genetic history and mode of…
Q: in blood and inereases the level of phospholipids. What are mechanisms of the therapeutic effeet of…
A: There are few points about methionine . It is Sulphur containing , glycogenic and essential amino…
Q: QUESTION 4 In the resting state: voltage-gated Na+ and K+ channels are both closed voltage gated Na+…
A: Voltage-gated ion channels: a type of transmembrane proteins that results in formation of ion…
Q: label the parts of the internal and external anatomy of Pinctada margaritifera shown in the photo
A: Classification Kingdom : Animalia Phylum : Mollusca Class…
Q: Is it more correct to describe a mushroom as haploid, diploid, both or neither? Explain.
A: Mushroom: A mushroom, often known as a toadstool, is a fungus' fleshy, spore-bearing fruiting body…
Q: The intracellular fluid has: high levels of K+, low levels of Na+, and many large anions low levels…
A: Intracellular fluid is the cytosol within the cell.It contains water, dissolved solutes and…
Q: During meiotic prophase in a eukaryotic cell, Spo11 initiates recombination by causing a…
A: Homologous recombination is initiated in meiosis by numerous programmed DNA double-strand breaks…
Q: After transformation, you are interested in your plasmid efficiency. You saw 90 colonies after…
A: Transformation is the process of genetically modifying the host cells by inserting foreign DNA. The…
Q: Did enterococcus avoid characteristics and descriptions of laboratory procedures and method…
A: Enterococcus is a species of bacteria that can be found in both people and animals' intestines. It…
Q: Give an example of founder effect in the human population
A: The founder effect is the reduction in genetic variation that results when a small subset of a large…
Q: What are the advantages that a biology student can do to advance science and technology in campus?
A: Biology students has both theoretical and practical knowledge about how things work they can…
Q: Which of the following is the best definition of parthenogenesis? O A single organism producing both…
A: Reproduction is the process occurring in living organisms that involves the development and…
Q: what is eukaryotes
A: Cell is tiny chief elemental unit of the body that accounts for various life processes. There are…
Q: It is possible to genetically alter sexual behavior in Drosophila True False Question 5 The Cycle…
A: * Genes control the sexual behaviour that can control species specific differences in courtship…
Q: ee radicals are very stable, which is why they accumulate in our body to cause agin
A:
Q: codon and anticodon
A: A codon is a sequence of three nucleotides or triplets present on mRNA, which encodes for a specific…
Q: You are contracted by the City of Ottawa to estimate the size of the population of small mouth bass…
A: A naturalist estimated the total number of rainbow trout in a certain lake using the…
Q: Which of the following diets is NOT recommended for long-term and sustainable body weight control?…
A: Diet is a process to maintain and stabilizes one's unhealthy lifestyle. Diet does not actually means…
Q: Which of the following hormone regulates BMR? A. Insulin B. Leptin C. Calcitonin D. Thyroid hormones
A: Introduction :- basal metabolic rate is the rate of energy expenditure per unit time when they are…
Q: 3. The speed of DNA replication at a replication fork is about 100 nucleotides per second (on each…
A: The DNA replication is the process by which new DNA is synthesized from the old DNA by the…
Q: Q/ What are the types of Water distiller?
A: *Water distillers are the machines that are used to purify water using distillation process, which…
Q: What is the etymology of the plant species podocarpus costalis (C.Presl)? I need complete answers…
A: The podocarpus costalis plant is native to central and southern China. The genus name Podocarpus is…
Q: 13' 5' 13' + A represents spliceosome introns and B represents Group II introns A represents Group…
A: Exons can be defined as expressing sequences whereas introns can be defined as intervening…
Q: What is the effect of treatment of CER cells with chloroquine? Explain.
A: General Concepts Clinical Manifestations Rabies virus causes acute infection of the central nervous…
Q: You are studying cancer progression in mice. Your results show the following pathway in which two…
A: Nature of given proteins in cell division and cancer.
Q: All Gnathostomes have: I) mineralized teeth II) lung derivatives II) vertebrae O A. I & II B. I &…
A: Gnathostomes belongs to kindom- animalia, phylum- chordata. includes both cartilaginous & bony…
Q: pancreas cell that had been incubated in labeled amino acids for 3 minutes and immediately fixed and…
A: The endoplasmic reticulum is a network of membrane-enclosed tubules and sacs (cisternae) which…
Q: WRITTEN TASK OBJECTIVE: To describe the concepts learned about plant organizational structures.…
A:
Q: What is an example of how multiple alleles affect a trait
A: Introduction :- Multiple alleles are different versions of the same gene that have the same effect…
Q: Anti - A Anti-B Known A Known B Patient 1 4+ 3+ Patient 2 4+ 3+ Patient 3 2+ 4+ Patient 4 3+ 29-30.…
A: Answer 29-30 :- Patient is Type B. Answer 31-32:- Patient is Type O.
Q: explain how this relates to both resiliency and biodiversity
A: Resiliency means the potentiality of an ecosystem to regain its normal pattern after damage or…
Q: What effect does a protein produced by Gordian worms have on their cricket host? O makes them…
A: Gordian worms: these are commonly known as horsehair worms. Their scientific name is Spinochordodes…
Q: I do not how to answer this question. Kindly help me fill out the blanks. Thank you!
A: Plant physiology is the science which deals with the function of cells, organs or the plant as a…
Q: Examine the graph in figure 4. Write an essay analyzing the data to explain how dams have impacted…
A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…
Q: What are the target cells of sars-cov-2? What do these cells have in common
A: Sars-cov-2 is a virus which causes infection that spreads from the the infected person to other…
Q: na synapse: O The pre-synaptic cell is always a neuron The post-synaptic cell is always a neuron…
A: A presynaptic cell is a cell that produces action potential and transmutes it to the postsynaptic…
Q: Which of the following substances can move in and out of the cell via simple diffusion? oxygen water…
A: Diffusion is defined as the net transfer of a substance (liquid or gas) from a high-concentration…
Can Unknown or Tentative specimens be identified to species on the basis of a BLAST search?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- What are type specimens? Why are they important?Soalan / Question 3 a) Berikan fungsi utama kekunci dikotomi. Give the main function of dichotomous key b) Kenalpasti langkah-langkah untuk identifikasi spesis berdasarkan kekunci dikotomi. Identify steps for species identification based on dichotomous key. c) Berdasarkan kladogram pada Rajah 1, terangkan secara ringkas ciri-ciri pada label (i), (ii) dan (ii) Based on the cladogram in Figure 1, briefly describe the characteristics on (i), (ii) dan (ii) label. Conifers Lilies Mosses Ferns (outgroup) (ii) (ii) Node (i) Rajah / Figure 1Please provide answer to the other problem asked: Diagnostic Key Characteristics for Genus ID using the dichotomous key of Lobban & N’Yeurt (2006)
- What traits support classifying H. habilis and H. rudolfensis as separate species? (Use complete sentences. Minimum of 2 sentences.)Why should the specimens be accurately identified/named, labelled, and described?Paraphrase/Describe the following dating methods: Law of Superposition, Dendrochronology, Paleomagnetism/archaeomagnetism, Radiocarbon dating, Potassium-Argon dating.
- Read the abstracts and answer the following questions: a)Did the researchers employ a combination of morphological and molecular data to determine evolutionary relationships of organisms? b) what type/s of data were used in the study? b)Compare the results of your streak and pour plates. Which method achieved the best separation of species?Based on the information from the following table and the provided phylogenetic tree, what kind of species classification is shown? A B C D E F G H 1 J K L M N O Form of Male Genitalia 1 1 L L L L L L L L L L L L L r T Pits) or Tubercles E P P T T T T T P P P P P Р P P O Phenetic Species Concept O Blological Species Concept O Phylogenetic Species Concept O Sympatric Species Concept Blayple (OUTGROUP) beaver Dan, AZ -Twentynine Paime, CA -Harkavilla, UT D-Chilchinbio, NM -Vermilion Cas. AZ 64 -F-Mone Lake, CA -G-Coral Pink Danes, UT H-Pyramid Lake, N -Crescent Dunes, MV Meno Lake CA -K-Olancha CA -Olancha, CA --Winnemucca, NV -El Mirage, CA Lo-Dumont Dunes, CA Form of dorsal ridges M₁ M₁ FFFFFFFFFF M Ma M₂ M₂
- The approach to estimating phylogenetic trees is most like the approach of which species concept? 2) A) Morphological species concept B) Biological species conceptC) Subspecies concept D) Phylogenetic species concept Then explain why the answer is correct and the rest are inccorect.From the DNA sequence data for the eight species (A through H) shown below, what is the genetic distance between Species A and Species C? O 4 5 6 1 O 7 2 3 4 Species A ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAG ACT Species B ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAGACT Species C ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species D ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT E Species Species F ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT G ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT Species H ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT 5 6 7Which of the organisms in A, B, C, D, E is not of the same species? Discuss how to identify if it is the same species or not.