Using the model above, illustrate the urea cycle.
Q: If the pH of a voledronic acid solution is 5.8, and the voledronate concentration is 9 mM, what is…
A: Henderson Hasselbalch equation can be used to determine the concentration of a weak acid in an…
Q: 6. Explain br
A: Enzymes have an important role in human beings. Enzymes have a tendnecy to speed up the reactions.…
Q: Name and discuss the non covalent interactions that maintain protein structure
A: Proteins have different levels of conformation. They are, the primary structure, secondary…
Q: pH cannot affect the enzyme - activity A. True B. False 2
A: "Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: The pentose phosphate pathway: Produces heat through simultaneous activation of both catabolic…
A: Pentose phosphate pathway is a metabolic pathway. It takes place in plastids in plant cell while in…
Q: Metabolic processes that generate FADH2 are: (Select all that apply). Krebs Cycle…
A: FADH2 are reducing equivalents that are generated during catabolic processes. Examples of catabolic…
Q: Answer the numbers 1 & 2 1. Positive with Molisch Test and Benedict Test but negative with both…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: -Why do we need pacemakers, which problems will a pacemaker prevent from.
A: Pacemaker which is very important component of heart it Plays vital role in circulation of blood…
Q: The first step in glycogenesis is the attachment of a-D-glucose to In this process, glucose…
A: Blank 1 - Phosphate group. - In the first step of Glycogenesis Glucose is converted to…
Q: Krebs cycle products/acetyl CoA molecule are 4 CO2, 3 NADH, 1 FADH2, 2 ATP 4 CO2, 6…
A: Krebs cycle or citric acid cycle or tricarboxylic acid(TCA) is a series of wight processes that…
Q: 5. Consider the isomerization of glucose-6-phosphate (G6P) into fructose-6-phosphate (F6P): G6P F6P…
A: Glycolysis is a metabolic pathway which results in formation of pyruvic acid along with the release…
Q: biosynthesis. Malate carries acetyl CoA to the cytosol, the site of fatty acid
A: Acetyl-CoA is the primary building block for the synthesis of fatty acids from scratch. However,…
Q: Determine the solvation shell from alanine. Report this value and discuss it.
A: Solvation shell of a molecule is the a set of molecules that are interacting with the solvate…
Q: Give the positive result for the test of ribose.
A: Biochemical testing involves the methods used for the detection of biological molecules and also has…
Q: Section A – Answer ALL questions A 1 month old baby is failing to thrive, with poor feeding and…
A: To measure rate of reaction we measure either the rate of consumption of the substrate, where the…
Q: Based on the quantitation data, please indicate how you would dilute the following samples. Fill in…
A: DNA shows maximum absorbance at the wavelength of 260 nm. Hence the concentration of DNA in solution…
Q: QUESTION 2 CH3COO-C₂H5 + H₂O CH3COOH + C₂H5OH Ethyl acetate Acetate Ethanol Ethyl acetate, acetate…
A: Ethyl acetate, acetate and ethanol were added to water solution in concentrations of 0.3M and left…
Q: How important are lipids in our body? Explain.
A: Lipids are organic substances that are insoluble in water and soluble in organic solvents like…
Q: Chlorophyll has iron as the metal center of the porphyrin ring. True False
A:
Q: Differentiate saponifiable the two classifications of lipids, and non-saponifiable.
A: Lipids are molecules that are insoluble in water and soluble in organic solvents like ether,…
Q: Discuss the central role of glutamate in nitrogen metabolism in both muscle and the liver.
A: Many of the α-amino acids' amino groups are accumulated in the liver as the amino group of…
Q: Which of the following metabolic processes directly involve Acetyl Coa (both as an immediate…
A: Acetyl CoA is intermediate and a product of many metabolic pathways. Acetyl CoA is directly involved…
Q: All the reactions involved during gluconeogenesis occur in the cytosol except the one catalyzed by…
A: Gluconeogenesis is the process of synthesis of glucose from non Carbohydrate sources like aminoacids…
Q: how the function of two or three different lipids is connected to their structure. be meaningful; ●…
A: Introduction: Macromolecules are large molecules within the cells. It is made from thousands of…
Q: where did the 10=101 come from? and then how did you get 10/1 as the ration?
A: In this case, the pH is greater than the pKa value of the lysine side chain. It means the proportion…
Q: HO-CH CH II CH Q-CH2CH2N(CH3)3 --=0 동_들 2-0- -CH-CH2 C=0
A: The given structure has a polar head group, and two hydrophobic groups present in it. It means the…
Q: What is the clinical AST?
A: AST catalyzes the reversible transfer of an α-amino group between aspartate and glutamate in liver.
Q: The Km of liver glucokinase is _____ than typical blood glucose concentrations. At typical blood…
A: Glucokinase, gluco is glucose and kinase is an enzyme which is known to phosphorylate a substrate.…
Q: How is glycogenolysis being regulated?
A: Glycogenolysis is very important metabolic process , glycogenolysis is basically a breakdown of…
Q: The glycosaminoglycan polysaccharide chainsthat are linked to specific core proteins to form the…
A: Proteoglycans are the proteins bound to glycan units that are mainly amino and uronic acid…
Q: The hypoxanthine analogue Allopurinol, which effectively treats gout , has no effect on the severe…
A: Alloprinol is structural analog of the natural purine base , hypoxanthine. Hypoxanthine is an…
Q: 1. Directions: True or False. Write an O if the statement is true, or write an X if the statement is…
A: Drugs are chemical compounds used to treat a condition of a patient.
Q: Give applications of enzyme kinetics
A: Enzyme kinetics: It is the quantitative study of enzyme catalysis. It measures reaction rates and…
Q: The principle behind the test for phosphate is oxidative reaction, conversion of organic form to…
A: Phosphate is an important form of phodphorous that is present in organic and inorganic forms.…
Q: in every Acetyl CoA entering ETC, how many ATPs are produced?
A: Glycolysis as well as the TCA cycle both are processes involved in cellular cellular metabolism. In…
Q: A. Is ATP required for this transport process to occur? Explain why or why not. B. Consider only…
A: A- No ATP is required for the transfer of oxygen from ECF to the cytoplasm because the transfer…
Q: lanosterol
A: The formation of cholesterol through different biological components is called cholestrol…
Q: How is acetyl coA carboxylase being regulated?
A: Acetyl coenzyme A (acetyl CoA) is a metabolic intermediate that participates in various metabolic…
Q: draw the structure of the substrates of the pentose phosphate pathway and write down the enzymes and…
A: The pentose phosphate pathway (or the hexose monophosphate shunt HMP Shunt pathway) is a metabolic…
Q: Which of the following statements is TRUE about fatty acid biosynthesis? Group of answer choices:…
A: Animals can obtain fatty acids from the diet and from de novo synthesis inside the cells. During…
Q: In centrifugation, the components of a given mixture are subjected to CENTRIFUGAL force, which…
A: Cell organelles include mitochondria, nuclei, vacuoles, ribosomes, plastids, peroxisomes, and…
Q: Based on intermolecular attractions, why is honey, which is made up of carbohydrates, 2,000 times…
A: A fluid's viscosity is a measurement of its resistance to deformation at a certain rate. As a…
Q: The first half of glycolysis is called investment phase or preparatory phase because a ATP is…
A: Glycolysis occurs in the cytoplasm of the cell irrespective of the presence or absence of oxygen.…
Q: Consider the complete oxidation of one mole of simple TAG containing lignoceric acid residues…
A: During the digestion of a triglyceride the fatty acids that are released are broken down in a series…
Q: Please follow the discussion in the photo upon answering the problem below. Please provide an…
A: Field efficiency is described as the ratio of effective field capacity to theoretical field capacity…
Q: Complete the table below for the gluconeogenesis with their corresponding precursor molecule…
A: Gluconeogenesis is a metabolic process that results in the synthesis of a glucose molecule C6H12O6…
Q: Using a generalized terminology (i.e. neither CIII nor CIV specific), explain how complex III and IV…
A: The transfer of electrons from one complex to another results in the release of protons to the…
Q: Today, due to the pandemic most people stay at home and most of them gain weight. Many weight loss…
A: Introduction: Carnitine is a quaternary ammonium compound that is important for transporting fatty…
Q: Which of the statement(s) is/are TRUE? 1. Desaturation is the process of introducing another carbon…
A: Synthesis of Fatty acids occur as acetyl CoA units and NADPH react by the action of enzymes like…
Q: Explain briefly but concisely 2. How would riboflavin deficiency affect the functioning of the…
A: Riboflavin is also called vitamin B2. It is a water-soluble vitamin. Through its coenzymes, it…
Using the model above, illustrate the urea cycle.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- + edu.au/courses/26618/quizzes/67364/take The image below shows the urea cycle. Based on the information in the image, which of the following is the most effective way of reducing the production of urea? CNH, Fumarate Arginine H₂O Arginase NH3+ C=N Arginino- succinate AMP + PP₁ NH₂ Arginino- succinase UREA CYCLE Urea ATP Argininosuccinate synthetase Ornithine H₂N H₂N 2 Citrulline Rate- limiting Ornithine 1. Carbamoyl phosphate synthase 1 N-acetyl glutamate H+ADP P₁ NH3 HCO3 ATP Carbamoyl Phosph. NH₂C-PO4 Ornithine 2. Citrulline formation P Citrulline C-NH₂ transcarbamoylase Aspartate NH₂ CYTOSOL MITOCHONDRIAL MATRIX https://canvas.uts.edu.au/assessment questions/356957/files/1562677/download? verifier=gRMPoy7VCgDrvn6QNfkZxDSsbLUwP1gRxFB3dLPjThe sodium/calcium exchanger (NCX) transports sodium into and calcium out of cardiac muscle cells. Describe why this transporter is classified as secondary active transport.Please briefly explain the ATP_modulated actomyosin cycle.
- >MK585652.1 Sardinella tawilis voucher TaSt3 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial GGTGCTTGAGCAGGGATAGTAGGGACTGCCCTAAGTCTCCTAATTCGGGCGGAGCTAAGCCAGCCCG TTTCTTCATAGTGATGCCAATTCTAATTGGGGGTTTTGGGAACTGGCTCGTCCCTCTAATGATCGGGGC TTCTCCTAGCCTCTTCGGGCGTAGAGGC GGGCAGGGACGGGTTGAACAGTATACCCGCCCTTGGO ATCTCGTCAATTCTTGGGGCGAT ACCACAATTATTAATATGAAACCCCCTGCAATT CAGTCCTGGCTGCCGGGATCACTATGCTATTAACAGATCGAAACTTAAATACAACTTTCTTCGACCCTGCAGGAGGAGGAGACCCAATTCTATACCAACACCT The highlighted text refers to the Gene origin Gene identity Accession number O Species identity GGACGACCAGATTTACAACGTCATCGTCACGGCACATGCCTTCGTAATGAT TCCCGCGAATAAACAACATGAGCTTCTGGCTCCTTCCCCCTTCCTTCCTTC of the sequence? SGGGCCTCTGTCGACCTTACCATCTTCTCACTCCACCTAGCAGGT TTGAGCTGTTCTCGTAACCGCTGTGCTTCTCCTTCTCTCCCTTCExplain why the symptoms of a partial defi ciency in a urea cycle enzyme can be attenuated by a low-protein diet.What is the end product of catabolism of the pyrimidine basethymine? Unlike uric acid, the end product of purinecatabolism, excess amounts of this molecule do not causeproblems comparable to gout. What circumstances causeexcess amounts of the end product and why doesn’t a goutlike illness result?
- Why the Ezyme activity deacreses when the MgCl2 concentration increases to 4mM onwards? Discussit is known that exercise is good for diabetics. explain how GLUT 4 transporters may be involved in this beneficial effect of exercise.urses / MEDBAS145en 21-22Spring / 2021-2022 Spring Semester / Final Which of the following pairs depict the absolute specificity of the enzyme? Select one: O O O O a. All of them b. Hexokinase - Glucose c. Lactase - Lactose d. Lipase - Triacylglycerol
- Explain how genetic mutations of phosphoribosyl pyrophosphate synthetase causing superactivity lead to excessive uric acid production.Show where trypsin and chymotrypsin would cleave the following peptide. Tyr-Ile-Gln-Arg-Leu-Gly-Phe-Lys-Asn-Trp-Phe-Gly-Ala-Lys-Gly-Gln-GlnB. After treatment with peroxyformic acid, the peptide hormone vasopressin is partially hydrolyzed. The following fragments are recovered. Propose a primary structure for vasopressin.Phe-Gln-Asn Pro-Arg-Gly • NH2 Cys-Tyr-Phe Asn-Cys-Pro-Arg Tyr-Phe-Gln-AsnC. Consider the following peptide: Gly-Ile-Glu-Trp-Thr-Pro-Tyr-Gln-Phe-Arg-LysWhat amino acids and peptides are produced when the above peptide is treated with each of the following reagents?1. Carboxypeptidase2. Chymotrypsin3. Trypsin 4. DNFBD. From the analytical results, deduce the primary structure of a peptide isolated from the Atlantian orchid that contains 14 amino acids.Complete hydrolysis produces the following amino acids: Gly (3), Leu (3), Glu (2), Pro, Met, Lys (2), Thr, Phe. Treatment with carboxypeptidase releases glycine. Treatment with DNFB releases DNP- glycine. Treatment with a…10. Answer ALL parts of this question. Prostaglandin-endoperoxide synthase 2, also known as cyclooxygenase- 2 or COX-2, is an enzyme that in humans is encoded by the PTGS2 gene. (a) Explain how this enzyme facilitates prostaglandin biosynthesis by highlighting two key functions. (b) Describe one role for the COX-1 enzyme. (c) Name one condition that the selective COX-2 inhibitors Vioxx (Rofecoxib) and Celebrex (Celecoxib) were used to treat. (d) Name and draw the chemical structures of 4 other small molecule OCOX-2 inhibitors and identify 3 similarities/common features with respect to Rofecoxib and Celecoxib. (e) Name a therapeutic reason for targeting COX-3. Describe the function and therapeutic utility of non-steroidal anti- (f) inflammatory drugs.