Q: Where would the repressor be bound in an E. coli cell (nonmutant) that is NOT growing in lactose? O…
A: In E. coli, lactose is the substrate for the enzyme beta-galactosidase and it regulates the…
Q: When RNA polymerase transcribes DNA, only one of the two DNA strands is used as a template.…
A: Transcription is the process in which a DNA strand gets transcribes into RNA by the help of RNA…
Q: Bönus questión: Which of the following statements is FALSE with regard to Bacteria? O 165 FRNA…
A: RNA nucleotides are linked together by 3’-5’ phosphodiester linkages. The three min RNA in all the…
Q: Signal molecules from embryonic cells cause transcriptional changes in nearby target cells in the…
A: Cell signaling(cell communication) is defined as the process the cells use chemical signals to…
Q: An operon is repressible—a small effector molecule turns off itstranscription. Which combination(s)…
A: Introduction:Two main stages are there at which gene is expressed: transcription and translation.…
Q: A type of RNA that has a “clover-leaf shape” with three hairpin loops. A.hnRNA B.rRNA C.mRNA…
A: RNA or Ribonucleic acid is a polynucleotide composed of ribonucleotides. These are formed from DNA…
Q: Na →→ K
A: An operon is a set/cluster of multiple genes which are transcribed together to produce a single mRNA…
Q: 5' Cap 1. Eukaryotes only Pribnow box 2. Prokaryotes only Activator protein 3. Eukaryotes and…
A: The prokaryotes and eukaryotes both contain DNA as genetic material. The small segment of DNA is…
Q: Which of the following genes have internal promoter elements? 5S FRNA MRNA snRNA None of the above
A: Promoter : the sequence that are important in the initiation of transcription of a transcription…
Q: In order for a new variant to become dominant in the population, it must have a(n) _________________…
A: Not all varieties have an impact on evolution. Hereditary variations found in egg or sperm cells are…
Q: Which of the following types of point mutations will not produce a change in amino acids and…
A: Answer: MUTATION : It is the change occured in the nucleotides of DNA/genome sequence , this is…
Q: Which of these molecules is produced by a regulatory gene? O promoter O operator O operon O…
A: a gene that controls the creation of a protein (such as a genetic repressor) that limits the rate of…
Q: Which of the following is true about transcription? O transcription begins at a start codon and ends…
A: Transcription is the process of making RNA from the template strand of DNA. It takes place in the…
Q: RNA processinga. removes the exons, leaving only the introns.b. is the same as transcription.c. is…
A: Transcription is the first step of gene expression that involves the formation of RNA molecule from…
Q: Depict the RNA transcript in the box below 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA…
A: DNA undergoes the process of transcription to copy itself into RNA. The segments of RNA that can be…
Q: What will happen if RNA polymerase fails to attach to the promoter? O Translation Will begin early.…
A: Introduction "Transcription Is The Process Of Formation Of An RNA Molecule From DNA". One Of The…
Q: What type of RNA corresponds to the statement? Prokaryotic Eukaryotic FRNA MRNA TRNA hnRNA RNA FRNA…
A: RNA or Ribonucleic acid is one among different biomolecules. They are also composed of nucleotides;…
Q: A promoter: is a small stretch of DNA that binds to proteins that initiate transcription is a small…
A: A promoter is a small stretch of DNA that binds to proteins that initiate transcription.
Q: An anti-codon is on what kind of molecule? O DNA O TRNA O polypeptide O MRNA
A: An anticodon is a tri-nucleotide sequence which is complementary to the codon sequence present on…
Q: What would be the best match? inducible operon, on O transcription is part of translation O…
A: Inducible operon is regulated by inducers which can on or off the operon for example lac operon is…
Q: Many transcription factors function as dimers. The binding sites of dimeric transcription factors…
A: In eukaryotes the transcription process relies on transcription factors (like general transcription…
Q: When a protein needs to be made, a signal is sent to a cell to turn on the ____ that codes for the…
A: Transcription and translation are the two processes that are involved in the central dogma of life.…
Q: Genetic manipulation causing expression of a particular gene in an organism that normally does not…
A:
Q: Which level of gene regulation is involved when more polypeptides are synthesized from a given mRNA…
A: Transcription: It is a process of synthesis of mRNA transcript from DNA template by the enzyme RNA…
Q: In bacteria sigma factors: 1. Transcript factors 2. Specialized subunit of the core enzyme 3.…
A: In prokaryotic (bacteria) transcription process the RNA polymerase perform the synthesis of RNA…
Q: What is one advantage or Transcription and translation can occur simultaneously It provides an…
A: Exons are coding sections of an RNA transcript, or the DNA encoding it, that are translated into…
Q: The following diagram depicts the elements at the: Ba cgcc tataan 999 AC ATT BRE TATA box Inr DPE…
A: The diagram depicts elements at the Promoter :
Q: Which of the following is correct in prokaryotes? O All operators are cis elements. O All gene…
A: The correct answer is option 4th i.e.All Promoters require a trancriptional activator protein.
Q: Innoor an A |RROTEL HERE........god ba
A: In this question we have to describe about the process of translution.
Q: The absence of tryptophan (trp) in E. coli A) O produces an inactive trp repressor B) O causes…
A: The gene regulation in prokaryotes (E. coli) is controlled by operon system. On operon system…
Q: The lac repressor is a trans-acting protein that affects the function of transcription in the iac…
A:
Q: Transcription factors are allowed to enter and exit the nuclease at all times. 1 A▾ B I U S X₂ x² $$…
A: The above statement is true.
Q: What are exons? Amino acid sequences that code for a functional protein O Sites where repressor…
A:
Q: You are lovely little gene which makes the actin protein (the cytoplasmic cytoskeleton protein). You…
A: Introduction: Gene is a unit of heredity. It contains the genetic information. It is made up of DNA.…
Q: dỗ the lác, trp repressor and CAP protein have in common? O They have a Helix-Turn-Helix Motif O…
A: Bacteria employ polycistronic expression of genes. The genes are arranged as a unit called an…
Q: BONUS: Within a cell, positive sense single stranded RNA acts as O FRNA O SİRNA tRNA O MRNA
A: Introduction: Positive-strand RNA viruses or +ssRNA viruses are a group of viruses that are related…
Q: The lac operon is usually in the ________ position and is activatedby a/an ________ molecule.a. on,…
A: An operon is a group of genes, which have a common regulator and promoter and also transcribed as a…
Q: Two genes can be right next to each other on a chromosome but get trån rates and times because it…
A: All organisms are composed of numerous cells. Cells are the functional and the structural units of…
Q: Questión 15 The following statements best describes the RNA structure EXCEPT A it is usually single…
A: Answer : Option D is correct. - according to the question asked above, option (d) cannot describe…
Q: Which of the following is characteristic of genes and gene regulation in both bacteria and…
A: Genes are generally defined as the way that they are been collections of nucleotides that code for a…
Q: The following diagram depicts the elements at the: Ac TTC g99 Eca cgcc tataan ATT BRE TATA box Inr…
A: The core promoters are contiguous DNA sequences sufficient to initiate the accurate initiation of…
Q: The binding of the inducer to the repressor causes the repressor to O bind to the operator. O stop…
A: Lac operon is a type of gene expression in prokaryotes. There are genes that code for different…
Q: In the txp operon, a repressor protein acquires a mutation such that it cannot bind to tryptophan.…
A: BASIC INFORMATION TRYPTOPHAN OPERON This system is known as Repressible Operon System. It can also…
Q: "In this mutation, the AGC is transcribed into UAG." O missense mutation nonsense mutation O silent…
A: The replacement of a single base pair leads to the appearance of a codon i.e. stop codon, which is…
Q: Retroviral reverse transcription occurs in: O The nucleocapsid O The cytoplasm O The nucleus The…
A: When retrovirus infect a cell, it's envelope is left outside the cell. Only the capsid containing…
Q: What is RNA polymerase doing on the lac operon in the presence of lactose? it is inactive and not…
A: In 1961, Jacob and Monod formulated the operon model in bacteria (E.coli) to know how the regulation…
Q: Which of the following changes may cause a gene product to not loose functión? Prevent or reduce…
A: Introns and exons are found in the mRNA transcripts and introns are removed via the RNA splicing…
Q: Eukaryotic gene transcription can be regulated by attenuation. O True False
A: Attenuation is an regulatory component found all through Archaea and Bacteria causing untimely end…
Q: A mutation can alter an organism's phenotype via Select one or more: O a. synonymous changes to a…
A: Mutation is the sudden change in the base sequence of the nucleotide sequence of the DNA resulting…
Q: Gene B has a mutation in its promoter sequences changing TATA to GAGA. What will this mean for…
A: Transcription is a process under central dogma, where RNA polymerase can bind with template strand (…
Step by step
Solved in 2 steps
- Figure 9.10 In certain cancers, the GTPase activity of the RAS G-protein is inhibited. This means that the RAS protein can no longer hydrolyze GTP into GDP What effect would this have on downstream cellular events?Nucleation of straight, single line microfilaments is mediated by which of the following? Rho GTPase and Formin Rho GTPase and Arp 2/3 Cdc42 GTPase and Arp2/3 OCdc42 GTPase and Formin 14 < Previous1. Huntington's disease (HD) is an autosomal dominant, 12 neurodegenerative disorder caused by a pathological expansion of CAG repeats in the gene encoding for a protein called huntingtin. CAG codes for glutamine, and huntingtin protein containing > 42 ex- tra C-terminal Gln residues causes pathology. There has been sig- nificant evidence that energy production is impaired in HD, but the origin of the hypometabolism, i.e., glycolysis vs. oxidative phosphor- ylation, was not established until fairly recently. wild-type 10 mutant 8 2 The diagram on the right compares in the upper diagram the total ATP production generated in cultured (wt) STHDHQ7/Q7 and mu- tant STHDHQ111/Q111 striatal neuronal progenitor cells. Within the standard error of the measurements, the ATP production proved un- expectedly to be equivalent from both types of cells. To probe the two different sources of ATP production in the cells, the investigators carried out similar experiments with permeabilized cells…
- Match the protein on the left with the mechanism of how the protein is activated on the right. Beclin-1 XBP-1s Rheb LC3 IRE-1 [Choose] [Choose] Phosphorylation Binding another protein to form a complex Dephosphorylation Cleavage Binding of GTP Dimerization Splicing in cytoplasm [Choose] [Choose]What will happen if both SRP54 and SRalpha are bound to GTPgammaS instead of GTP? SRP54 and SRalpha will always bind to the sec61 translocon, and ribosome will fail to translate proteins into the ER lumen SRP54 will never bind to SRP receptor, and ribosome will always translate proteins into the ER lumen SRP54 and SRalpha will always bind to the sec61 translocon, and ribosome will always translate proteins into the ER lumen SRP54 will never bind to SRP receptor, and ribosome will fail to translate proteins into the ER lumen3. Coronaviruses express a nucleocapsid protein that is needed for propagation, transcription, and assembly of the virus. The nucleocapsid protein must be phosphorylated by a kinase in the host cell to carry out these functions. One such kinase that has been recently reported is glycogen synthase kinase 3 or GSK-3. The following is the 10-letter sequence of the nucleocapsid protein that is recognized and phosphorylated by GSK-3: SSRGTSPARM. Note: pk. N-terminus = 9.3; pk. R = 12.5; pK. T= 13; pK. S= 13; pK. C-terminus = 4.3 a) What is the sequence of the peptide using the three-letter amino acid abbreviations? b) Draw the chemical structure of the peptide when it is at pH 8. Assign charges and label the peptide bonds. c) What is the pl of the peptide? Do not use an online resource to calculate this value. Show your work to receive credit.
- 2. The mannose 6-phosphate receptor is located predominantly in endosomes and the TGN, but about 10% of the mannose 6-phosphate receptor molecules are in the plasma membrane. Suppose you have an antibody that associates with the mannose 6-phosphate receptor and blocks the ability of the receptor to bind mannose 6-phosphate. Suppose further that this association is rapid and effectively irreversible. If you incubate cells with the antibody for a brief time and then wash away excess antibody, the cells continue to sort lysosomal enzymes normally. But if you incubate cells continuously with the antibody for a prolonged time, the cells begin to secrete lysosomal enzymes. a) How would you interpret this result? b) Suppose that the antibody has been fluorescently labeled by covalently attaching a fluorophore. If you examine cells that have been incubated continuously with this labeled antibody, what types of fluorescence patterns would you expect to see at different time points after…Stimulation of map kinase can help regulate cell division and cell mass. the following effects of map kinase activation explains an increase in cell mass. Phosphorylation of RSK (kinase and the subsequent phosphorylation of S6 ribosomal subunit. Phosphorylation of myosin light chain Phosphorylation of glyceraldehyde dehydrogenase phosphorylation of histone H1 none of these1. Which of the following signaling events is NOT engaged downstream of phospholipase C (PLC)-gamma activation? a. Calcium ion (Ca2+) release from the endoplasmic reticulum (ER) b. Heterodimerization of the subunits c-Fos and c-Jun to form the transcription factor AP-1 c. IkappaB degradation and resulting translocation of NFkappaB into the nucleus d. Recruitment of protein kinase C (PKC)-theta to the plasma membrane e. PIP3 generation at the plasma membrane which recruits and activates Akt, leading to cytoskeletal remodeling
- You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 ТТCGAGCTCTСGTCGTCGAGATACGCGATGATATTАСТGGТААТАТСGGGАTGCАСТАТС 3' 5' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATAÇECCTACGTGATAG ΤΑTC promoter RNA polymerase Practice Question 4 C) What are the first 5 amino acids encoded by this gene? N' C' ribosome6. Explain why the RTK signaling pathway includes the extra complication of having a protein (Ras) that switches between GTP- and GDP-bound states.Match the protein on the left with the type of activation of that protein on the right STAT Smad PKA Ras NFKB Nuclear receptor [Choose] [Choose] GTP binding serine phosphorylation Interaction with Galpha Cleavage by y-secretase destruction of a protein by proteasome tyrosine phosphorylation second messenger ligand binding [Choose] [Choose] [Choose]
