Watch the video called "(OLD VIDEO) Osmosis". Pick one quote from the video, state the time it took place-state why you picked this particular quote? Include the the time of the video.

Q: Why are rRNA a good choice for resolving the ancient evolutionary relationships among the three…

A: introduction A single-stranded molecule called RNA, also known as ribonucleic acid, is essential for…

Q: Nick is a male who displays a rare mitochondrial disease. Nick's wife, Anne, is unaffected. Should…

A: The mitochondrial genome is not passed on to kids by males. Since sperm contain few mitochondria and…

Q: Differenciate and explain the virus family and virus subfamily by their definition below and give…

A: Introduction  Viruses are tiny infectious agents that consist of genetic material (DNA or RNA)…

Q: What is the application of Gel Electrophoresis in healthcare? Cite at least 2 specific examples.

A: Gel Electrophoresis: A laboratory technique called gel electrophoresis is employed to divide…

Q: Lebel and give typed explanation

A: There are a few important points : Cell is the structural and functional unit of life. On the basis…

Q: 4. A different population of lemmings have a third allele (i.e. a third version of the same gene)…

A: Genetics is the study of the functioning and main codes of variation and heredity. Heredity is…

Q: Describe the basic pathways of sympathetic innervation from the spinal cord to the effector organs…

A: he nervous system is a complex network of specialized cells, tissues, and organs that coordinate and…

Q: Answer the following questions: 1. What was the first antibiotic and what was its importance? 2.…

A: As per bartleby guidelines only 3 questions can be answered. Please post remaining questions…

Q: The genetic difference within or between populations in the gene pool and/or gene frequency is…

A: Gene Pool: It refers to combination of all the genes including all type of alleles present in…

Q: Fill in the scoring matrix using Smith-Waterman with match = 2, mismatch = -1 and gap = -1. (2/4)…

A: Introduction  The genetic code is the set of instructions that determine how the sequence of…

Q: For a cell line with a mutated Ras protein that is always inactive, which of the following…

A: RAS protein is a family of small GTPases that play a crucial role in signal transduction pathways…

Q: Select All That Apply (SATA) question. What do male Drosophila (fruit flies) have that females do…

A: Fly species belonging to the taxonomic order Diptera and family Drosophilidae include Drosophila…

Q: Which factors cause vasodilation? a decrease in O2 an increase in adenosine a decrease in K+ an…

A: Vasodilation means when the lumen of the blood vessels gets widened and this would increase the…

Q: DNA synthesis

A: DNA synthesis is the process of creating deoxyribonucleic acid (DNA) molecules, either naturally or…

Q: Which is not a factor of distortion? DNA, pressure, temperature, chemicals

A: Here we need to figure out that from the supplied possibilities which is not  a factor of…

Q: Make an outline about Virus genus involving difference in host range, serologic reactions as…

A: Introduction :- In biology, a genus is a taxonomic rank used in the classification of living…

Q: DNA size (in bp) at which Tss is equal to Tm is a) 10000 bp b) 100 bp c) 500 bp d) 1000 bp e)…

A: DNA has two separate melting and strand separation temperatures, designated as Tm and Tss,…

Q: Which of the following statements concerning fermentation is TRUE? a) Fermentation ultimately…

A: Introduction  Fermentation is a metabolic process by which energy is generated in the absence of…

Q: 4. CHOOSE THE RIGHT ANSWERS: according to Federal Law of the Russian Federation "On Circulation of…

A: Medicines can have powerful effects on the body and potentially cause harm if not used correctly.…

Q: 4. In humans, pointed eyebrows are dominant over smooth eyebrows. Angela’s father has pointed…

A: The pointed eye brow is dominant over smooth eye brow. Let P allele encodes pointed eye brow. It is…

Q: In Polymerase Chain Reaction (PCR). Primers are short segments of DNA that. Obalance the pH of a…

A: Polymerase Chain Reaction or PCR is a molecular technique allowing the synthesis of multiple copies…

Q: What is unusual about the receptor for steroid hormones? A. The receptor is located in the cytoplasm…

A: Steroid hormones are lipid-soluble signaling molecules that diffuse across the plasma membrane to…

Q: Bariatric surgery can improve outcomes for obesity at every level of prevention. True or false?

A: Obesity: Obesity is a medical condition characterized by an excess of body fat to the extent that it…

Q: A male having genotype AaBbCc mates with a female that has genotype aabbCc, where A is dominant to…

A: Genetics helps us understand how traits pass to progeny and it also helps to understand the…

Q: Dopamine drip ordered to run at 4MCG/KG/MIN dopamine bag has a concentration of 400 MG/250 ML. PT…

A:

Q: Question 24. The temperature of stringent washing (Tw) is calculated using the Tm (melting…

A: Stringency is used to define the degree of similarity between the probe and the nucleic acid bound…

Q: For the DNA sequence AATGTCATTGC, what would be the equivalent code for the complimentary RNA…

A: Introduction :- In genetics, a complementary sequence is a sequence of nucleotides that forms base…

Q: Question 5. In the Southern blotting procedure, the agarose gel is treated with respect 0.25 N HCI.…

A: Southern blotting can be used to identify individuals based on variations in their DNA sequences.…

Q: Energy is needed O a. To maintain basal metabolic rate (BMR) O c. To maintain body temperature O…

A: You require energy, which comes from your diet in the form of calories, whether you're asleep,…

Q: Next-Generation Sequencing (NGS): NGS is a newer testing technique that is used to identify the…

A: Next-Generation Sequencing (NGS) is a process used to rapidly sequence the nucleic acid in an…

Q: Heart Murmur What causes it? Describe the exact damage to the heart. How is it treated? With…

A: Heart murmurs are noises produced by the heart's fast, choppy blood flow. A stethoscope is a tool…

Q: DNA duplication TAT GCA CTA ATA TAT GCA [triplets] ____ ____ ____ ____ _____ ____ Protein synthesis,…

A: The process of duplicating or replicating the given template stand DNA is called replication. Next…

Q: Using an example or two, describe the impact of climate change on our lives. Include some thoughts…

A: Climate change: Climate change refers to the long-term alteration of the Earth's climate, primarily…

Q: Which are significant predators of bacteria (select those that apply)? O Protists Bacteriophages

A: Bacterial predators are organisms that feed on bacteria as their primary food source. These…

Q: Colorblindness is a sex-linked traits in humans. If a normal-visioned mother and a colorblind father…

A: One of the main risks associated with colorblindness is the potential for accidents or mishaps due…

Q: 20. The theory of natural selection does not depend A Heritability B. Purpose C. Reproductive…

A: When a species adapts to new environment conditions over a period of time for survival is called…

Q: Mentions research 6 titles related to zootechnics.

A: Zootechnics is the art of managing handling, breeding,  and care of animals. It is also called…

Q: you had a polyC RNA and put it in a reaction with ribosomes and tRNAs (and all of the other…

A: The process of the synthesis  of messenger RNA with the help of the template strand of DNA is called…

Q: Discuss the advantages and disadvantages of different methods for delivering hormones.

A: Hormones are chemical messengers that regulate various bodily functions, and they can be delivered…

Q: Which of the following is the correct order of components in a reflex? Place in correct order…

A: Reflex arc is an involuntary response. It does not occur according to our will. It is a sudden…

Q: You have isolated a strain of mutant yeast cells that divide normally at 25 degrees Celsius but…

A: Cell division is a normal process that occurs in all living organisms to produce new cells to…

Q: What is the process for retrieving soluble, luminal ER proteins that "leak" out of into the…

A: Endoplasmic reticulum (ER) is an organelle present in eukaryotic cells that is in charge of protein…

Q: What is the protein recommendation by age? Gender?

A: Protein is an important part of a healthy diet and its recommended intake varies according to a…

Q: There are some exceptional free living organisms from the tree of life that lack rRNA true or…

A: Ribosomal RNA (rRNA) is a type of RNA molecule that is a fundamental component of ribosomes, the…

Q: Dominance has a direct relationship with gene prevalence. True False

A: A single is comprised of gene two alleles that can be inherited from parents. A gene's dominant…

Q: If you have a population of wolves where 36% of the population has the dom allele for brown eyes (B)…

A: The Hardy-Weinberg principle describes the relationship between allele frequencies in a population…

Q: In the phylogenetic tree of animals, which is a monophyletic group? O Pig and peccary Pig, peccary,…

A: A monophyletic group is a group of organisms that includes a common ancestor and all of its…

Q: Question 1 The addition of a calculation of Carrying Capacity (K) enables us to more accurately…

A: Logistic growth is a type of population growth that occurs when the growth rate decreases as the…

Q: transcript the pre-mrna code, ACCUACGCGCCACACGUUCUCUACUAUCCCC, into mature mrna

A: Nucleic acids are "proteins essential to the structure and operation of all living cells. Nucleic…

Q: 8. If a female carries the gene for muscular dystrophy (MD) and she marries a normal male, then what…

A: Introduction :- Color blindness is a genetic disorder that is typically inherited in an X-linked…

Homeostasis

Homeostasis is a self-regulatory process through which different biological systems maintain constant internal environmental conditions to compensate for environmental changes. In human physiology, it is a process of self-regulating internal, chemical, and physical conditions at an optimal level for survival. The stability through homeostasis can be attained through dynamic equilibrium, in which there is a continuous change until it reaches its systemic conditions.