What is a common feature of the voltage sensitive Ca++, Na+ and K+ ion channels? A single polypeptide sequence made up of 4 domains A voltage sensing S4 transmembrane domain A transmembrane S5-S6 hydrophobic subunit that binds the membrane A voltage sensing extracellular P loop

What is a common feature of the voltage sensitive Ca++, Na+ and K+ ion channels? A single polypeptide sequence made up of 4 domains A voltage sensing S4 transmembrane domain A transmembrane S5-S6 hydrophobic subunit that binds the membrane A voltage sensing extracellular P loop

Human Physiology: From Cells to Systems (MindTap Course List)

9th Edition

ISBN:9781285866932

Author:Lauralee Sherwood

Publisher:Lauralee Sherwood

Chapter3: The Plasma Membrane And Membrane Potential

Section: Chapter Questions

Problem 5RE: Using the answer code on the right, indicate which membrane component is responsible for the...

See similar textbooks

Related questions

Q: A deficiency in cholesterol will have the largest effect on the activity of what organ

A: Introduction:- Cholestrol is a type of sterol. Sterols are the class of steroids that have a…

Q: What are the different anatomical joints used in a block start for a sprint? What is happening at…

A: Sprint athletes brace their feet against starting blocks at the beginning of a race to prevent them…

Q: List some genera of free-living and symbiotic nitrogen-fixing bacteria.

A: Nitrogen-fixing bacteria are microorganisms that convert nitrogen gas from the atmosphere into a…

Q: Predict how blood pH levels will change as a result of the kidney’s reabsorption or excretion of…

A: The buffer that maintains the pH of human blood involves carbonic acid (H2CO3), bicarbonate ion…

Q: Neutrophil

A: I

Q: What hormones are involved in renal functions, and what 2 systems, ultimately what affects water…

A: The kidneys assist in maintaining the body's fluid balance by filtering the blood. Small tubules in…

Q: Summarize the evidence regarding the sum of evolutionariy modifications from the given putative…

A: Evolution is the gradual change in the inherited traits of biological populations over many…

Q: four main types of tissues on of

A: Tissue: It is defined as the group of cells which are having similar shape and specific function.…

Q: Match the following events with the stages in Meiosis Prophase I…

A: These are the stages of meiosis first division which is associated with reproductive cells. The egg…

Q: How does sexual selection differ from natural selection? a. It does not require heritable traits. b.…

A: Natural selection typically results in people who are well-adapted to their environment, whereas…

Q: The frequency of the Z allele in a population of 2000 diploid turtles is 0.2. 250 turtles from a…

A: Allele frequency refers to that how common an allele is present in a population.

Q: What are the behaviors that need to be changed? What health promotion actions would help?

A: ANSWER) As the lady is diagnosed with osteoporosis therefore the most important changes which should…

Q: What are the dissimilarities between polyalphabetic and monoalphabetic ciphers?

A: Forensic science is involved with the gathering and evaluation of physical evidence as well as other…

Q: you something like this photo taken from the internet…

A: Plants belong to the kingdom plantae.plants aee able to perform photosynthesis process,because of…

Q: Outline the general process of transcription (dna->rna) include a diagram a) include the basic…

A: Transcription is the process of synthesis of RNA from DNA. It involves three steps, initiation,…

Q: VNTR markers: 0 ☐ 0 are usually detected by DNA sequencing are the first used by forensic services…

A: VNTRs (Variable number tandem repeats) also referred to as microsatellites or simple sequence length…

Q: lipase an enzyme?

A: Enzyme is usually a protein molecule that acts on a reaction and increases the speed of the reaction…

Q: Two LINKED genes that are 12 cM apart control seed color and pest resistance in peas: seed color =…

Q: In low to middle-income countries, the risks of disease from environmental factors are high for…

A: Low- and middle-income nations bear a disproportionately large portion of the burden of diseases…

Q: Explain why you chose A or B, etc. Provide a logical explanation defending your answer choice. Q1:…

A: 1 & 2) The greatest species richness refers to the number of different species that live in an…

Q: buttressing system. Different skull functions show species developments. What different activities…

A: Ho.o habilis and homo erectus were archaic humans. Homo habilis lived around 2.4 million years ago…

Q: if you replaced the hox genes that are normally expressed in a dolphin fin with the hox genes that…

A: Gene expression is predominantly regulated at the transcriptional level, owing to protein binding to…

Q: using environmental DNA (eDNA), instead of traditional field-based capture techniques, to study…

A: e DNA or environmental DNA is the presence of DNA of an organism in a particular region. Each and…

Q: From the following DNA strand: AAGCTAGGATTGCC How many codons would be present?

A: A codon is made up of three nucleotides. Such codons are abundant in messenger RNA and consist of a…

Q: Tell me how this image shows the relation between grape and banana

A: A phylogenetic tree's branching structure illustrates how many species or other groupings developed…

Q: 2. What general conclusions can you derive from the data as to the effect of soil enrichment on the:…

A: Introduction Soil enrichment is a fertiliser catalyst that increases the effectiveness of…

Q: How does position effect influence gene expression? TI The movement y! CDC The movement of the…

A: ANSWER : The correct option is: All of the above answers are correct

Q: What color is the alpha gene spot on the microarray? Answer: Yellow please explain why is the…

A: The microarray can be described as a lab-on-a-chip. It can be used to detect the expression of…

Q: 2. Restriction Enzyme Mapping - use any resources to assist you including the hints below. A…

A: Focus only on EcoR1. Than focus on EcoR1 and HindIII. Than focus on EcoR1, HindIII and Pst1

Q: DO NOT COPY IN GOOGLE OR BARTLEBY QUESTION: Why is there a need for replica plating? How is…

A: Replica plating is technique related to microbiology. In replica plating colonies inoculated into…

Q: 2. On the replication bubble below, draw the newly synthesized strands of DNA as they would be seen…

A: DNA replication occurs at body temperature (37 degrees Celsius in humans) with the assistance of a…

Q: DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC…

A: One of the core concepts of molecular biology is the flow of information from DNA to RNA to…

Q: Cytotoxic T Cells attack O pathogens, rapid growth and division O pathogens, apoptosis (cell death)…

A: Introduction Immunity is defined as the ability of the body to fight against the pathogens. There…

Q: Given the short-tandem repeats (STRS) of the child below. Which adults below could be the parents?…

A: A short tandem repeat is a microsatellite with repeat units of 2 to 7 base pairs in length, and the…

Q: how does the recently developed dna technology help scientists establish a more accurate…

A: Evolutionary taxonomy is a branch of biology that uses phylogenetic relationships (shared descent),…

Q: What is the one cell type that does the most to coordinate and control the adaptive immune response?

A: The immune system's adaptive immune system, sometimes referred to as the acquired immune system, is…

Q: 1a) Name the start codon and the three stop codons for translation. 1b) What amino acid is…

A: An mRNA codon is a triplet or triple-nucleotide sequence that codes for a certain amino acid during…

Q: For each experimental set up (geotropism and phototropism), identify the dependent and independent…

A: In an experiment the independent variable is the cause and the dependent variable is the effect. The…

Q: WHAT LEVEL OF ORGANIZATION? Identify each image as either an atom, organism, organelle, molecule,…

A: The levels of organisation given in this image from smallest to laregst are: Atom, molecule,…

Q: Use the Chain of Infection to describe Legionnaire’s disease

A: Introduction Legionnaire’s disease it is type of pneumonia caused by legionella bacteria. lung…

Q: Discuss the structure of a neuron and the function of nervous tissue. (KEEP IT SHORT PLEASE

A: Neurons are building blocks of nervous system. They receive and transmit signals to different parts…

Q: Which of the following statements is false about the impacts of climate change? Choose all that…

A: Climate change is having a wide range of impacts on the environment, including increased…

Q: do strawberry and raspberry fall under the category of eudicots

A: The eudicots, also known as eudicotyledons, are a group of flowering plants that are primarily…

Q: what is the frequency of the rarest variant you can detect during deep sequencing of a tumor cell if…

A: A tumour cell is a type of abnormal cell that is produced and reproduces at an abnormally rapid…

Q: and horns, to a dragon from another true-breeding line with no forelimbs, no wings, and no horns.…

A: During sexual reproduction, during the meiosis phase, the DNA sequences that are near to one another…

Q: Explain what a competitive antagonist is using a named example. In your answer, explain why a…

A: When the agonist cannot bind to the active receptor in the presence of the competitive antagonist,…

Q: Sahelanthropus tchadensis Anatomical structures/characteristics

A: Sahelanthropus tchadensis is the oldest known species in the human family record. This species lived…

Q: Choose ALL the events listed below that occur in the cytoplasm of eukaryotes. Select one or more: a.…

A: In eukaryotic cell, translation process occurs in cytoplasm. Translation is the process, that…

Q: Which of these would be a first line of defense against microbial infection?

A: Ans : Our immune system has three lines of defense to fight against microbial infection. Those are :…

Q: There are various types of connective tissue. Explain how differences in this tissue type aid in…

A: Connective tissue is found in between other tissues and is present everywhere in the body, including…

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

What is a common feature of the voltage sensitive Ca++, Na+ and K+ ion channels?
A single polypeptide sequence made up of 4 domains
A voltage sensing S4 transmembrane domain
A transmembrane S5-S6 hydrophobic subunit that binds the membrane
A voltage sensing extracellular P loop

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

hich of the following statements is true about actin: OActin is translated by free ribosomes O Dyneins move toward the minus end of actin filaments actin can bind to GTP O actin filament is stabilized by ADP-binding
Ligand binding of a (????) causes conformational changes in the receptor that free the associated G-protein to interact with other membrane proteins Voltage gated ion channel GPCR Ligand gated ion channel Ligandase pore
Many proteins are attached to the membrane phospholipids via a covalently linked polysaccharide. Which of the following would be an example? Glycophosphatidylehanolamine anchors O All of the other are correct O Glycophosphatidylinositol anchors O Glycophosphatidylcholine anchors
What is the free energy change for the transport of calcium ions (Ca++) across a membrane from a region (left) where the concentration is 50 micromolar to a region (right) where the concentration is 50 micromolar? A membrane potential of 60 mV exists across the membrane where the right side is more negative than the left side. The temperature is 25 C.
Which of the following families of actin-binding proteins promote actin filament polymerization? sequestering proteins nucleating proteins severing proteins capping proteins motor proteins
Using the answer code on the right, indicate which membrane component is responsible for the function in question: 1. channel formation____________________________________ (a) lipid bilayer 2. barrier to passage of water- __________________ (b) proteins soluble substances ____________________________________ (c) carbohydrates 3. receptor sites 4. membrane fluidity 5. recognition of self 6. membrane-bound enzymes 7. structural boundary 8. carriers
Neurofilament proteins assemble into long, intermediate filaments , found in abundance running along the length of nerve cell axons. The C-terminal region of these proteins is an unstructured polypeptide, hundreds of amino acids long and heavily modified by the addition of phosphate groups. The term “polymer brush” has been applied to this part of the neurofilament. can you suggest why?
An analog of cGMP, 8-Br-cGMP, will permeate cellular membranes, is only slowly degraded by a rod cell’s PDE activity, and is as effective as cGMP in opening the gated channel in the cell’s outer segment. If you suspended rod cells in a buffer containing a relatively high [8-Br-cGMP], then illuminatedthe cells while measuring their membrane potential, what would you observe?
Peripheral membrane proteins O may noncovalently interact with phospholipid heads O contain many hydrophobic amino acid residues if found on the cytosolic leaflet but contain hydrophilic residues if found on the extracellular leaflet O contain only alpha helical membrane spanning domains O have covalently attached lipid or fatty acid anchors All of the other are true
What does the following schematic represent? Selectivity filter wwww mm Lipid bilayer MM Sensor Aqueous pore Channel protein O An ionic pump O An ion channel Gate An ion exchanger O A transmembrane protein
What type of membrane protein is shown in the figure below? HIN NH Cysteine-rich domain Protein tyrosine kinase domain COO "Ooc O Receptor protein O Transport protein Structural protein O Channel protein
The rapid upstroke of a SA nodal cell action potential is due to the opening of voltage-gated Na+ channels. answer should clearly state whether or not the statement is correct and then concisely explain why. the answer should be 3-5 sentences and address all of the points in the statement. Here is an example: Both transmembrane carrier proteins and transmembrane channel proteins can mediate active transport of a hydrophilic solute through a cell plasma membrane. This statement is incorrect. Movement of a solute through a channel protein is always passive, whereas carrier-mediated transmembrane transport can be either passive or active. A transmembrane channel protein creates a pore through the membrane allowing for simple diffusion of a hydrophilic solute down a concentration gradient through the membrane. In contrast, transmembrane carrier protein interacts with and ‘escorts’ a hydrophilic solute through the membrane and is capable of transporting a solute against a concentration…