What is a nosocomial infection? Explain why the urinary tract, lower respiratory tract, and give an surgical wounds are the most common sites of nosocomial infections? explanation for all three sites.
Q: 4) What is the predominant form of ammonia in a solution at pH 7.0? Approximately what fraction is…
A: pH stands for power of hydrogen. pH scale is a commonly used scale to measure the acidity or the…
Q: Which of the MHC pathways is activated by phagocytosis of extracellular particles? O Class I MHC O…
A: The MHC (major histocompatibility complex) system plays a critical role in the adaptive immune…
Q: Why is it not necessary to include a caloric content statement on the information panel
A: "Calorie" is defined as the "energy" of a food product. It is a unit of measurement that defines how…
Q: Attempt E 1. 2. 3. 4. MacBook Pro Endocrine System 5. 7. 8. Submit A
A: Endocrine glands and exocrine glands are both types of glands that secrete substances in the body,…
Q: You digest 4 uL of plasmid DNA that is 50 ng/uL concetration in a total volume of 20 uL. You run 10…
A: ANSWER) The amount of DNA digested can be calculated as follows: Total amount of DNA = volume x…
Q: What is the difference between complementary and alternative medicine? Give a few examples of each.
A: Cancer treatments that are often not used by professionals include complementary and alternative…
Q: who invented Olaparib
A: A drug called olaparib is used to treat some cancers, specifically ovarian and breast cancers that…
Q: Which type of prokaryote is shown in this image? A. Photoheterotroph B. Chemoheterotroph…
A: R. H. Whittaker proposed five kingdom classification. This system is based on cell structure,…
Q: . Write a 1 to 2--page essay explaining the side you have chosen and why. • Introduction paragraph.…
A: Introduction Climate change is a topic of significant concern in today's world. The Earth's climate…
Q: 38) The following treatment(s) control bacterial growth by damaging the DNA structure of bacteria:…
A: Understanding the development and survival of microorganisms is one of the most fundamental aspects…
Q: i 2. Predict and explain the effect on GAL1 transcription, in the presence of galactose alone, of…
A: GAL1 transcription is the mechanism by which RNA polymerase II in eukaryotic cells converts the GAL1…
Q: Some ecologists have dismissed the terms "R" and "K" and have replaced them with the terms…
A: Species can broadly be classified into two categories based on their rgrowth rate and rate of…
Q: a. glucose, fructose, and sucrose b. galactose, glucose, and fructose c. ribose, fructose, sucrose,…
A: Monosaccharides are the simplest carbohydrate molecules that cannot be broken down by hydrolysis…
Q: The above product water molecules are generated in which eukaryotic cell compartment?
A: The question asks the location where water is produced in case of eukaryotic cells. We will find out…
Q: 19) The base pairs of a DNA molecule are held together by which of the following? a. hydrogen bonds…
A: DNA acts as a genetic material in almost all living organism. DNA is composed of nitrogenous bases…
Q: 2. What is an infectious dose and what can it tell you about a microorganism? Would you develop an…
A: An infectious dose is the number of microorganisms (bacteria, viruses, etc.) required to cause an…
Q: The number of bacterial cells increases from X to 32,000,000 in 2 hr. The generation time is 20…
A: Bacterial growth refers to the increase in the number of bacterial cells in a population over time.…
Q: 4) What is the significance of colonies that develop within otherwise clear zones of inhibition? If…
A: Antibiotic susceptibility testing, such as the Kirby-Bauer disk diffusion test, plays a crucial role…
Q: 3. Where in the eukaryotic cell does transcription during transcription? occur and what molecule is…
A: Nucleic acid is a macromolecule present inside the nucleus of the cell . In this , genetic material…
Q: Examine the karyotypes of Jacob and PAtau syndromes. List the similarities and differences between…
A: Chromosome are present in the nucleus of the cell. They are thread-like structures. These are…
Q: a group of three nucleotides codes for one amino acid. these groups of three nucleotides are called…
A: Amino acids are the building blocks of proteins. They are organic compounds that contain an amino…
Q: 7. Explain how the problem of antibiotic resistance presents an example of evolution. 8. Explain how…
A: Evolution is a gradual and slow process that occurs for millions of year and responsible for the…
Q: Extreme UV exposure leads to the SOS response in bacteria. By what mechanism does the SOS response…
A: The SOS response is a DNA damage response mechanism in bacteria that is activated when the cell is…
Q: 4) Cells are made up of: a. Carbohydrates b. Lipids c. Proteins d. Nucleic acids e. All of the above
A: A cell is the basic unit of life, and it is the smallest structure capable of carrying out all the…
Q: If one did a research and the purpose was Identifaction of Fungal specifically Mushrooms Using…
A: If the purpose of the research was the identification of fungi, specifically mushrooms, using…
Q: Complete the sentence: The end result of a gene going through the central dogma of biology in any…
A: Molecular biology is a branch of biology where scientist deals with the structure and function of…
Q: 2. List three factors that are contributing to the decline of pollinator populations. 3. From an…
A: Growing new plants from vegetative components of an existing plant, such as roots, stems, or leaves,…
Q: In species with internal fertilization, the eggs often are attached to the outside of the female's…
A: Brood chambers are specialized structures in some species with internal fertilization that provide a…
Q: Question 3. It is not necessary to take precautions against shearing RNA during the purification…
A: RNA molecules are more prone to shearing than DNA due to their single stranded nature & smaller…
Q: Solution 1 Solution 2 M 16311 Solution 3 2.0 A 6. The following experiment was carried out at ILC…
A: Essential elements and nutrients are those that plants need to survive and complete their life…
Q: 2. Chronic myeloid leukemia (CML) is a blood cancer with adult onset. In most CML patients, The…
A: Chronic myeloid leukemia (CML) is a blood cancer that often involves the Philadelphia Chromosome…
Q: Is the concept of infectious dose applicable to Covid -19 infections? Why/Why not?
A: The "infectious dosage" is the quantity of a pathogen needed to cause an infection. It is improbable…
Q: Which is an example of secondary succession? Mark only one oval. A) Beach grasses colonize a newly…
A: Ecological succession is the gradual and steady change in species of a given area over time. There…
Q: Memory formation depends on the synaptic plasticity of the hippocampal synaptic pathways. True False
A: Synaptic plasticity refers to the ability of synapses, which are the connections between neurons, to…
Q: An amino acid mutation in the voltage-gated sodium channel that caused the voltage gate helices to…
A: Amino acids are organic compounds that are the building blocks of proteins. They contain an amino…
Q: 14) Which molecules are the major components of proteins? a. carbon, hydrogen, and oxygen b. carbon,…
A: PROTEIN > Proteins are biological macromolecules that are formed from mRNA during the process of…
Q: Which of the following factors DOES NOT affect pluripotency? O DNA Acetylation Oct4 Nanog miRNA's…
A: Pluripotency is the ability of stem cells to differentiate into all the cell types of an organism.…
Q: Which is an example of secondary succession? Mark only one oval. A) Beach grasses colonize a newly…
A: Secondary succession is the process of ecological succession that occurs after a disturbance that…
Q: What is the consensus sequence that precedes a translation initiating AUG on messenger RNA? Answer…
A: The translation is the third process involved in central dogma for gene expression. It involves…
Q: H₂5' P 3' Nitrogenous base 3' OH
A: DNA is a double stranded stable molecule which can still be broken down into its constituent by…
Q: Identify the base labeled B. cytosine thymine O adenine O guanine A C B D
A: Nucleotides are the building blocks of DNA and RNA. Nucleotide is composed of a sugar, phosphate and…
Q: 2) Indicate by writing “yes” or “no” whether amplification of a signal could occur at the particular…
A: An essential mechanism that permits cells to react to alterations in their environment is signal…
Q: 1. Describe the requirements for growing mammalian cells in vitro.
A: Growing mammalian cells in vitro is an important technique for decades in biotechnology. Cell…
Q: Answer choices for A: deletion, transversion, insertion, transition Answer choices for B: nonsense,…
A: In the given sequence, the translation starts from the mRNA sequence of the underlined part of the…
Q: Disadvantages of use of an oral contraceptive which contains only an estrogen the original…
A: Contraceptives are generally used to prevent unwanted pregnancy as well as to prevent the spread of…
Q: raw a figure of oxygen consumption (L·min´¹) over time from resting to the start of exercise at…
A: When a person exercises his muscles work harder, and his body uses more oxygen and produces more…
Q: How do inactivated vaccines prevent disease? Briefly describe what an inactivated vaccine is and…
A: Inactivated vaccines are a type of vaccine that contain killed or inactivated microorganisms, such…
Q: 5' AAGACCTATATAATGACGAACGATATT 3 TTCTGGATATATTACTGCTTGCTATAA 5¹ Coding strand: Template strand: 3'
A: Untranslated regions (UTRs) are extra sequences found in mRNA that are not translated. UTRs include…
Q: Which of the following is NOT correct about programmed cell death? O Apoptosis is mediated by RIPK3…
A: Cell death is the process by which a cell ceases to live and function. There are two main types of…
Q: You just finished plating your electroporatio products on your YPD-Zeocin plate and you think you…
A: Electroporation is a technique used to introduce foreign DNA into cells by applying an electric…
Step by step
Solved in 3 steps
- 1 - Define the term pathogen. a) Using MRSA, NOROVIRUS, ATHLETES FOOT and MALARIA as examples, identify the microorganisms (causal agent) involved in each disease. b)Provide some information on the microorganism for each disease e.g. structure C) Discuss 3 routes of entry that disease causing organisms use to enter the body.2. Indicate whether each of the following conditions ts typical of subacute, chronic, or acute infections. a. The patient experiences a rapid onset of malaise; symptoms last 5 days. b. The patient experiences cough and breathing difficulty for months. c. The patient has no apparent symptoms and is a known carrier. 3. Examine this case: Of all the hospital patients with infections, one-third1. Put the following in the correct order and describe each pattern of disease : period of convalescence, prodromal period, period of decline, incubation period, period of illness
- 1. What are the six components of the chain of infection? How does each component affect the cycle of the chain of infection? 2. Give a short list of the different ways on how to transmit a certain disease. Provide an example for each. 3. Why do you think proper handwashing is extremely important? 4. How are hazardous materials classified? What is NFPA and its functions?1- A. Define the term pathogen. B. Using MRSA, NOROVIRUS, ATHLETES FOOT and MALARIA as examples, identify the microorganisms (causal agent) involved in each disease. C. Provide some information on the microorganism for each disease e.g. structure D. Discuss 3 routes of entry that disease causing organisms use to enter the body.a. Explain the general relationships of the vector, the reservoir, andthe agent of infection. b. Can you think of an explanation for Lyme disease having such alow incidence in the southern United States? (Hint: In this region,the larval stages of the tick feed on lizards, not on mice.)
- 1) What is dumping syndrome?what is the cause,symptoms,and the cure of it ? One paragraph3. What host characteristics influence the development of infection?1.The Philippines is a developing country and many of its areas are classified as geographically- isolated and deprived. As such, a lot of parasitic diseases are reported. a. Cite five (5) parasitic diseases and elaborate on their causative agent, disease/ s they caused, mode of transmission and the prevention measures which can be applied. Tabulate your answers. b. Why are parasitic diseases not given so much of cognizant attention in the country? c. How can a student like you help in the lessening or eradication of the problem on parasitic infections? d. Discuss the relationship between parasites, people and poverty using the “lever model” of health.
- 2.- In a paragraph explain A) What is resident flora? B) How might resident flora prevent infection AND cause infection? (150 words)Explain 4 patholigical features associated with each of the following diseases caused by parasite. i) Trypanosoma gambiense ii) Giardia lamblia Use your knowledge and the mode of life of the above parasites to explain how diseased caused by these parasites could be controlled.1- A. Define the term pathogen. In a table give the following information: B. Using MRSA, NOROVIRUS, ATHLETES FOOT and MALARIA as examples, identify the microorganisms (causal agent) involved in each disease. C. Provide some information on the microorganism for each disease e.g. structure D. How are these microorganisms transmitted from person to person. (200 words) 2.- In a paragraph explain A) What is resident flora? B) How might resident flora prevent infection AND cause infection? (150 words) 3 - In a paragraph describe Describe how the skin and mucous membranes play an integral role in helping the body protect itself against infection. (150 words)