What is the role of a virus in gene therapy? O t carries the faulty DNA out of the patient's cells. O t reveals which cells carry the DNA causing the disease. O It causes the disease that gene therapy is aiming to cure. O It carries the healthy DNA into the patient's cells.
Q: This case study is used to help illustrate the respiratory content you have been studying. It will a...
A: #Chronic bronchitis- This the long term inflammation of bronchi. This is common caused in chain smok...
Q: e blank with the correct dilution for each tube in the series. tou 50 µl of patient serum 100 µl of ...
A: Dilution is the technique of lowering the concentration of a solute in a solution by merely adding m...
Q: A: Describe countercurrent exchange in your own words.
A: Most aquatic species have gills as their breathing systems. Mollusks and most amphibians have the mo...
Q: Which of the following statements about Chronic Traumatic Encephalopathy is FALSE? A. Repeated sub-...
A: Chronic traumatic encephalopathy is related to brain. It is a kind of brain disorder in which brain ...
Q: Watson and Crick used scientific reasoning, their knowledge of biochemistry, and the research of oth...
A: Many people believe that DNA was discovered in the 1950s by James Watson, an American biologist, and...
Q: your own words, please answer the question. It is a fact that insects are widely distributed in any...
A: Insects are the group of organisms belonging to the Phylum Arthropoda. some insects are causative ag...
Q: In which ways does the limb orientation of "advanced" tetrapods differ from that of "primitive" tet...
A: Tetrapods are the four limbed structure.And these limbs have derived from fins.The limbs of all tetr...
Q: the Chronic Myelogenous Leukemia (CML)
A: A disease in which the bone marrow makes too many white blood cells is known as the chronic myelogen...
Q: How are animal cell tight junctions and desmosomes (aka adhesion junctions) different?
A: Tight junctions form a water tight seal and prevent material from passing between cells. Desmosomes ...
Q: c) Outline the possible reasons for operating a sequential two stages system, instead of a single la...
A:
Q: Can you answer all the parts to this question regarding fish (please type the answer) Mammals hav...
A: Fish gills use a design called ‘countercurrent oxygen exchange’ to maximize the amount of oxygen tha...
Q: Which of the following are not found in all cells? Group of answer choices DNA Cell membrane cyt...
A: A cell is made up of three parts: the cell membrane, the nuclei, and the cytoplasm, which sits betwe...
Q: Methods of Bioremediation does not include Select one: a. Bioaugmentation b. Phytoremediation c. Bio...
A: Bioremediation: Bioremediation is a field of biotechnology that involves the removal of contaminants...
Q: Enumerate two conditions that may lead to transformation of cyst to trophozoite stage.
A: Introduction A parasite is an organism that lives on or in another creature and feeds on or at the e...
Q: Describe cyclic and non cyclic photo phosphorylation.
A: Photosynthesis is a metabolic process in which carbon dioxide react with water , sunlight and Chloro...
Q: It all about flowering plants-use for asexual and sexual reproduction example Please help it is due ...
A: Sexual maturity is the age in which the reproductive organs mature and mating occurs. In context of ...
Q: Enumerate two conditions that may lead to transformation of trophozoite to cyst stage.
A: The trophozoite is a motile vegetative stage that reproduces through binary fission and colonises th...
Q: Consider the following situation: The replicated chromosome 9 is separating during anaphase of mitos...
A: Introduction: A telomere is a segment of repetitive sequences found at the ends of most eukaryotes'...
Q: Which type of virus must contain an RNA replicase packaged in the viral particle in order to carry o...
A: A virus is a small collection of genetic code, it can be DNA or RNA, surrounded by a protein coat ,...
Q: EPITHELIUM.
A: The epithelium is a type of body tissue that forms the covering on all internal and external sur...
Q: C. Solve these problems by listing the given genotypes, test crosses, genotypic and phenotypic ratio...
A: Serrated leaf is a dominant feature in plants that is represented by the genotype(Aa Aa) whereas smo...
Q: 1. IDENTIFY THE BASIC TYPE OF EPITHELIUM. 2. GIVE THE SPECIFIC NAME OF THE EPITHELIUM. 3. IDENTIFY T...
A: A stratified squamous epithelium is a flattened epithelial tissue that are arranged in layers over a...
Q: The activated sludge process was developed from empirical knowledge and is now widely used for wast...
A: Activated sludge-The activated sludge process is a type of wastewater treatment process for treating...
Q: Below are the results for your unknown organism. S LM fluid 6 -L-M -s -LM fluid Please record your o...
A: Phenol Red It is recommended that the carbohydrate fermentation reaction be determined to isolate t...
Q: Why overwatering of plants results in yellowing of leaves
A: Introduction:- Plant growth is influenced by a variety of factors. Plants are sensitive to temperatu...
Q: A reaction in an anabolic pathway is found to have a large negative Gibbs Free energy. How likely is...
A: Gibbs free energy is basically defined as the amount of work done in the thermodynamic process when ...
Q: Student Exploration: Identifying Nutrients Vocabulary: carbohydrate, disaccharide, lipid, monosaccha...
A: Food consists of various nutrients that provide us energy to perform work and along with this it pro...
Q: how many bacteria/ml of the diluted broth would be present on average
A: 37 bacteria/ml of the diluted broth would be present on average.
Q: Explain how and why a researcher might use a DNA probe.
A: Probes , DNA probes -- Segments of DNA or RNA with the help of which cDNA or RNA segments of any org...
Q: Compare Class Maxillopoda and Class Branchiopoda
A: Arthropoda It is a much heterogeneous group including a variety of animals with divergent views conc...
Q: What is a primate and why do anthropologists consider it important to study them? What features do p...
A: Primates is belong to those groups of animals, thats under included humans, monkeys and animals like...
Q: The "Central Dogma of Life" states that the pattern of information that occurs most frequently in ou...
A: Central dogma is the process that occurs in the lifecycle of cell through which information present ...
Q: polymerase with 5'-3' as well as 3'-5' exonuclease and proofreading activity is Select one: a. Telom...
A: The error-correcting processes used in the genetics is known as the proof reading. During the proces...
Q: 3. Which line graph shows t@2 vehicle slowing down? Time (seconds)
A: In fig .1, given the distance versus time graph.From this speed of the vehicle at Every second is in...
Q: Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the MR...
A: Given: The shine- dalgano sequence is a ribosomal binding site that is found in bacterial and archae...
Q: Consider Mendelian traits versus polygenic traits. What impact do modifications, such as those offer...
A: CRISPR-Cas9 has recently become a popular set of tools for genetic engineering. By targeting specifi...
Q: Define cartilaginous joint
A: Human anatomy is the study of the shape, size, and structures of the human body. The body's structur...
Q: What salt did Meselson and Stahl use for their ultracentrifuge gradients? O NaCI O NH4CI O CSCI O Ca...
A: Given: DNA replicates semiconservatively. Matthew messelson and Franklin stahl performed an experime...
Q: Classify each example under the following characteristics of life (1) gathering and using energy, ...
A: Introduction Regardless of complexity, structure, habitat, or other factors, all living things on Ea...
Q: Identify the structures labeled a and b on the figure below. noitesinsgnO In
A: Chip budding is a grafting technique. A chip of wood containing a bud is cut out of scion with desir...
Q: 3. Someone in your office has the flu. How would the social habits of your office cause other people...
A: INTRODUCTION Answer of question number 3 is given below.
Q: 1. IDENTIFY THE EPITHELIUM. 2. IDENTIFY THE ORGAN. 1. 2.
A: The epithelium is the lining in the hollow organs and body cavities, or covers the internal and exte...
Q: Interested in exploring the genetic pathways that lead to neurological issues, you want to see if re...
A: Genetic diseases or disorders can take place in case of present of a mutant gene. The mutation can b...
Q: Match the structures (i-iv) to the correct molecules from the dropdown list provided. Not all molecu...
A: INTRODUCTION The figures in the question is matched with it's appropriate terms.
Q: Imagine that a couple is planning to have children. The male is heterozygous for Huntington’s diseas...
A: Introduction Heterozygous means that you have inherited various versions of a gene from each parent....
Q: A 2 NATALIA JAi CLAUDE !al O, A AB AB (A B 5 JANE ii 6 8 MARK |Bi ii MIGUEL DAVID JAJB JAJB |Bi JANE...
A: Introduction: Pedigree analysis is the study of a particular trait that is inherited from one genera...
Q: How does the increase in the influx of tourists affect the ecosystem of the city?
A: Increase in Tourism/Influx of Tourists negatively implacts Environmental conditions in that particu...
Q: With what region of the promoter does the the principal interaction between it and the RNA polymeras...
A: The process associated with synthesizing ribonucleic acid from DNA can be described as transcription...
Q: Complete the energy pyramid by writing the source of the energy for the food web and how much energy...
A: Introduction An organism's trophic level is the position it holds in a food chain. A food chain is a...
Q: What happens if you breed a patchwork fish with a blue scaled fish? 1. P1: _________ x _________ 2...
A: Codominance is a condition ;in which the phenotypic effects of each allele is observed in the hete...
12
Step by step
Solved in 2 steps
- QUESTION 4 After you get your gene block, you do a restriction enzyme digest and ligation reaction with the plasmid/gene, so you can proceed to bacterial transformation! How does the plasmid get into the bacteria though? O You mix the plasmid in lipids with several other plasmids to make lentiviral vector that'll infect all the other cells. O The plasmid will be transmitted through a pilus to the other bacteria. O You make the bacteria chemically competent using calcium chloride, and then subject the cells to heat shock O Bacteria will naturally take up the plasmid so you don't need to worry about it.Question 5 Review DNA sequencing and cloning tools. Which of these is not used to make a recombinant DNA? O restriction enzymes to create sticky ends of a plasmid O fragment from a different DNA cut by the same restriction enzyme O DNA ligase seals the recombinant DNA O denaturationQuestion 2. Retroviruses are used in gene therapy. The goal of gene therapy is to insert in the patient genome a copy of a functional gene that is defective in the patient. Since Retroviruses integrates their genome into the host genome they are ideal gene therapy delivery systems. What would be a potential risk of this type of treatment? The individual treated could be more susceptible to infection by other retroviruses Insertion of the retroviral genome into the host genome can cause dangerous mutations. There are not recognized risks with this gene therapy approach. Genes from the host can be inserted into the retroviruses and laterally moved to other cells.
- Question #3: CRISPR has been used to cure an individual from sickle cell. Below is a Sanger electropherogram of a sequence from a patient without sickle cell and one with sickle cell. Sequence from a normal individual mmmm Sequence from the diseased individual G T GIIC A GC A Se SCIENCEphe A G A SCIENCE SCIENCEphoto G a) Where is the change in the sequence and what is the consequence to the protein sequence of this mutation? b) Below is an image of the normal and diseased quaternary hemoglobin protein. What is different about the protein shape and why does that structure have a huge impact on its function (please name the function!)? Adult haemogBRAR G G G G A G Sickle Cell haemoglobin S Structure a s RARY COLIBRARY c) If you were to use CRISPR to modify the genome of a diseased individual, to which nucleotides might you design your guide RNA? Why? d) RNA Seq is used to determine off-target effects of Cas9 cleavage. Why is this an appropriate tool to determine these effects? e) Data on…Question 16 Why can't SNPS be detected by PCR and Gel Electrophoresis? O Because Gel Electrophoresis detects size differences in DNA and SNPS do not change the size of the DNA strand. O Because SNPS cause deletions so large that they are beyond the limits of this technique to detect. O Because SNPS affect proteins and PCR only works on DNA. O Because SNPS are too complicated to detect with this technology.Question 1: Which of the following processes is not involved in genetic engineering? A. DNA polymerases are used to seal the bonds between fragments B. reinserting DNA into living organisms C. recombinant plasmid gets inside a bacterial cell D. cutting out a DNA sequence E. changing a DNA sequence Question 2: In genetic engineering, vectors are needed in the process and play a crucial role because these molecules A. are able to covalently bond and carry foreign DNA into cells B. protect host cells from invasion by foreign DNA C. degrade nucleic acids D. help in replication
- Question 18 What is the function of the CRISPR-Cas system in nature? O part of the bacterial immune response against viral infection O a molecule involved in regulation of expression Oan enzyme complex involved in homologous recombination O bacterial conjugation system Question 19 Which of the following is FALSE in relation to CRISPR/Cas9? O Cas9 needs a PAM site consisting of an NGG sequence. Cas9 will malQuestion 8 The cloning a eukaryotic gene in a bacterial plasmid does not include extension gene inserted into a cloning vector such as a plasmid The vector is obtained by bacterial cells. O Host cells grown in culture to form a clone of cells containing the "cloned gene of interest" O formation of a recombinant DNAQUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…
- QUESTION 1 You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can sequence it. Based on the sequence below, which of the following primer pairs would probably work for PCR of this gene? Spike gene Sequence: 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTT TACTATCCTGATGAAATTTT. .. (it's really long so didn't post the whole thing.).TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTG ATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm = 60.5 °C in a standard qPCR mix) Reverse Primer: 5' GGG TGT CAA ATT ACA TTA CAC ATA - 3' (Tm= 59.6 °C in a standard QPCR mix) Forward Primer: 5'- ATG TTT ATT TTC TTA TTA TT -3' (Tm=D 47.2 °C in a standard qPCR mix) Reverse Primer: 5'- GCA AGA ACC ACA AGA GCA TGC ACC -3' (Tm= 68 °C in a standard qPCR mix) Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC -3'…Question 3 Bacteria defend against phages by Natural selection favors mutation can not be recognized by virus. O all of these except DNA replication O restriction enzymes CRISPR-Cas system O DNA replicationQuestion 25 What is a major drawback of performing genome editing with site-specific endonucleases over RNA-guided endonucleases? difficulty in transformation Necessity of protein cargo to facilitate the editing the need to genetically engineer a new endonuclease for each target sequence. Specificity is not achieved Question 35 Identify the disease: Affected people are usually born to unaffected parents. Parents of affected people are usually asymptomatic carriers. It affects either sex. After the birth of an affected child, each subsequent child has a 25% chance of being affected (assuming that both parents are heterozygous carriers). X-linked dominant Autosomal recessive Y-linked X-linked recessive Question 36 Using Sanger sequencing, starting from the sequencing primer, what is the sequence of the DNA sample ? Question 36 options: G T A C C C G A A A T C A G G A A G…