What is the size of Tray in the C snippet shown below? (Assume that 1 character occupies 1 byte) typedef char x[5]; x Tray[3];
Q: ) Show the order of individual bytes in memory for the following double word variable using little…
A: Actually, memory is a used to stores the data or information.
Q: For the four umbers, the first number and the second number are added to the third and fourth…
A: Answer : .model smalldatast9 db 13,10,"Enter First Number : "/$'st10 db 13,10,"Enter Second Number :…
Q: The following two programs run concurrently and are synchronized by binary semaphores S0 and S1…
A: We are given question on process synchronization where they are synchronized using binary semaphore…
Q: 51. What is the result of the snippet of code shown below if x=1?x<<2 a. 8 b. 1 c. 2
A: Initially x is storing 1 << refers to left shift operator
Q: Task: Given the following statement: short int X, Y, Z;…
A: In given problem, we have to check what will be the output when we exceed the range of a data type.…
Q: Q 24 ) Which one of the following is incorrect string declaration? a. char m[]={“exam”}; b.…
A: C. char m[]={“E”, “X”, “A”, “M”}; This is the invalid syntax : The null character…
Q: Question 2 Write a program to perform the operation: Multiply by 2. Assume the input data is stored…
A: Program to perform the operation :multiply by 2 is given below:-
Q: Given the following C++ code'snippet, provide the code to store the address of test grade in…
A: - We need the exact code snippet to store the address of test_grade in ptr_test_grade in c++. -…
Q: Q1) Write a program to find the largest of 30 (8-bit) numbers stored at memory locations starting at…
A: Algorithm – Load data from offset 500 to register CL and set register CH to 00 (for count). Load…
Q: Which code segment results in "true" being returned if a number is even? Replace "MISSING CONDITION"…
A: we can say that a number is an even number if that number modulus 2 is equal to zero. Given…
Q: Using Huffman code, we can compress the bits used for saving the characters in a file: (Table in…
A: //C++ program for Huffman Coding#include <iostream>#include <cstdlib>using namespace…
Q: 4. If x is declared as integer variable x= 313. How long would be the length of x in memory? (A) 2…
A: - The question wants to know that if x is a variable declared with x = 313 what will be the size of…
Q: A set of eight data bytes is stored in memory locations starting from XX70H. Write a program to…
A: The Answer is in Below Steps
Q: Character Frequency Character Bits Frequency Total Bits F Space 3 4 12 1 A 4. 12 H 1 M 1 3 4. 12 R…
A: // This is C++ program for Huffman Coding #include <iostream>#include <cstdlib>using…
Q: use Keil_v5 3. Assume r0- 0xBBFFABCD, r1 - 0x00000014. Write a program (including the 2 steps below)…
A: Assembly language <code> // ro = 0xBBFFABCD, r1 = 0x00000014 // ro &lt;-…
Q: 5. Using script file MATLAB/OCTAVE, find the area of the triangle determined by the points…
A: Here is the MATLAB code: %The 3 coordinate of triangle x = [2,2,0]; y = [-1,0,2]; z = [0,4,3];…
Q: What is output (printed) by the program (pseudocode) shown below. Assuming pass-by-value-result…
A: In pass by value, address/reference is not passed in function argument. Thus any change in function…
Q: University of Babylon College of Information Technology Department of Information Security…
A: Question 1: C++ Code: #include <iostream> using namespace std; int main(){ int marks;…
Q: 17. Please write the truth table for the following statement: p O q
A: ⊕ represents XOR XOR is the abbreviated form of Exclusive OR This will give us True only if both the…
Q: Q1) Write a program to add 3 numbers ( 2 bytes each), The 1" one is stored in memory locations…
A: Write a program to add 3 numbers two bytes each.
Q: Q1. Execute the following program using the following numbers 1. FA+ F4 2. FA + A5
A: Answer is given below-
Q: b. Assume that the addresses for the variables are as follows: x = 005FF7AC, y = 005FF7A0, p =…
A: *p=30, p=005FF7AC and &p 005FF794 *q=40, q=005FF7A0 and &q 005FF788 *p=40, *q=40 *p**q=1600
Q: Write a program to permanently store the data entered by the user. When user is done with Input,…
A: Required: Write a program to permanently store the data entered by the user. When user is done with…
Q: 5. Suppose that the variables 0x04 and Ox03 contain the values 0x33 and Ox44, respectively. What…
A:
Q: Use Python to create the following program: Use only one function "encrypt()" that accepts…
A: Answer: LETTERS =…
Q: SI, OOH CX, 5 AH, 'A' INC SI CMP AH, DATA[SI] LOOPNZ LOOP HLT DB 00, 2F, 41, 20, a. It stops when it…
A: B. It stops when CX becomes equal to 0
Q: Find out the errors, if any, in the following C++ statement: (i) cout<<"="a; (ii) m=5, n=12; o=15
A: Information technology and Network society is based in the communication technologies and the…
Q: Using the DUP directive, allocate space for 5 doublewords and 2 bytes in a data segment, then fill…
A: .data? var1 DWORD 5 DUP (?) var2 BYTE 2 DUP(?) 15 DUP ("&") 7 DUP ("%") 1 DUP ("M") .data? var1…
Q: time_t now=time(0); char*tm = ttime(&now); can you please explain this code? it is for c++. and…
A: time and ttime functions: The date and time of the current system time can be obtained in C programs…
Q: . What is the value of the following expression:24//6%3, 24//4//2 a. (1,3) b. (0,3) c.…
A: Please find the answer to the above question below:
Q: Q1) Write a program to subtract 2 numbers ( 2 bytes each), The 1" one is stored in memory locations…
A: LHLD 2033 XCHG LHLD 2044 DAD D XCHG LHLD 2066 DAD D SHLD 2055 HLT
Q: 1.Suppose you want to ask the user of your program to enter any character indicating an…
A: PROGRAM CODE: #include <iostream> // include header file for input output…
Q: 4. Three Char Apart by CodeChum Admin Do you like reading books? If you do, then you must have…
A: PROGRAM EXPLANATION: Include the header file. Define the main function. Create two character…
Q: Write a program using the Loop instruction to print all letters each in a new line as follows (must…
A: Note : As per guidelines we are supposed to answer one question per post , please repost other…
Q: You are required to make changes in the below programs and introduce the use of compaction where…
A: Compaction : It means reducing the lines of code, by removing the unrequired information or data…
Q: x:5, 15 and y: 10, 30 are given value What is the value of y for x=6 (use interpolation) A) 20…
A: To determine the value of y when x=6 using interpolation.
Q: Read the following code carefully to answer what it does: START: CLC MOV CX, 0002 MOV SI, 0300 MOV…
A: Code: START: CLC MOV CX 0002 MOV SI, 0300 MOV DI, 0302 LOOP: MOV AL (DI)…
Q: 10. Evaluate the following statement using infix evaluation algorithm and choose the correct answer.…
A: Ans: The following statement using infix evaluation algorithm and the answer is 4*2+3-5/5 a) 10
Q: 9. Based on the below Verilog statements, how many bits are there in the variable Y? Reg [15:0] A;…
A: Verilog, standardized as IEEE 1364, is a hardware description language (HDL) used to model…
Q: Discuss briefly what is wrong with the program block below. 101 if ( a != b) 102 { a…
A: The syntax for 'if-else' statement is: if { Statements; } else { Statements; } You can skip the…
Q: Write the python syntax for filling the area between two lines. Hint, call the two datasets A and B,…
A: Hey there, I am writing the required solution based on the above given question. Please do find the…
Q: Allocate memory for a string of 15 characters and assign “new string” to it. Print the string. Now,…
A: GIVEN: Allocate memory for a string of 15 characters and assign “new string” to it. Print the…
Q: Write a program to set b0,b1, reset b2,b3 and complement b6,b7 for the content of memory location…
A: ; set b0,b1.byte 0xC0 ; set b0,b1; reset b2,b3.byte 0xC2 ; reset b2,b3; complement b6,b7 .byte 0xC6…
Q: Calculate, how many bytes are utilized by the variables in the following program? i. var1 BYTE 20…
A: As per our guidelines, I can only answer one question. Kindly, put another post for other questions.…
Q: Assembly language (GNU gas at&t syntax) Write a program that subtracts var2 from var1, then put…
A: Assembly language code two substract two variables .All the variables are store in data segment as…
Q: Question 2 Write a program to perform the operation: Multiply by 2. Assume the input data is stored…
A: the solution of problem is given below:
Q: Which is not a TRUE statement related to functions in C? Select one: a. Call by address passes…
A: In C programming, In call by value, the value of the actual parameters is copied into the formal…
What is the size of Tray in the C snippet shown below? (Assume that 1 character occupies 1 byte)
typedef char x[5];
x Tray[3];
Step by step
Solved in 2 steps with 2 images
- (Numerical) Using the srand() and rand() C++ library functions, fill an array of 1000 floating-point numbers with random numbers that have been scaled to the range 1 to 100. Then determine and display the number of random numbers having values between 1 and 50 and the number having values greater than 50. What do you expect the output counts to be?(Data processing) A bank’s customer records are to be stored in a file and read into a set of arrays so that a customer’s record can be accessed randomly by account number. Create the file by entering five customer records, with each record consisting of an integer account number (starting with account number 1000), a first name (maximum of 10 characters), a last name (maximum of 15 characters), and a double-precision number for the account balance. After the file is created, write a C++ program that requests a user-input account number and displays the corresponding name and account balance from the file.(Data processing) Write C++ code sections to make the following decisions: a. Ask for two integer temperatures. If their values are equal, display the temperature; otherwise, do nothing. b. Ask for character values letter1 and letter2, representing uppercase letters of the alphabet, and display them in alphabetical order. c. Ask for three integer values, num1, num2, and num3, and display them in decreasing order.
- TEST INPUT: I Love C Programming Write a program to replace all the vowels with empty spaces in a sentence. For example- if your input string is "Hello World!!", your output string should be "H II W rld!!" [The sentence must be stored in a dynamically allocated memory.]C++ ARRAYS (The result should be as the image provided!) 3. Population In the Lithuanian register, the personal identification code data of the population is stored in the format SYYMMDDXXXX. Here: S- Gender: 3 (male, 1900-1999), 4 (female, 1900-1999), 5 (male, 2000-), 6 2000-), YY is the last two digits of the year of birth (00, 01, 02, 03, MM - month of birth number (01, 02, 03, ... 11, 12), DD - number of the date of birth (01.02, 03, ... 30, 31), XXXX - registration number (0001 ... 9999). Make a program that will find the dates of birth of the eldest Lithuanian man and woman and display them on the screen. The first line of the source data file contains the personal codes n (1 <n < 3000). Next, each line contains one code.C PROGRAM Create a c program that will convert number figures into words 1. You can use user-defined functions, string, array, and loops 2. Maximum input limit is 10000.00 Sample output (bold letters is for input) Enter amount in Peso: 143.50 You just entered P145.50 equivalent to One Hundred Forty Three and Fifty Centavos. Do you want to convert another amount? [Y|N]: N
- P A:00 1必% Q1: Write the C++ definition of 4 points a data structure (complexNumber). It contains two float data members (real) and (imag). 1 Add file Q2: Write a complete C++ 8 points program that reads the contents of the text file "mydata.txt", character by character. And appends them to the end of text file "myoutput.txt" . The main function calculates and prints the number of characters read and copied between the files. 1 Add file2. Test Scores File: test_scores.py Write pseudocode for the main() part of a program that asks the user to enter 4 test scores between 0 and 100, then displays a JCU grade for each score and also the average test score. When you have written the pseudocode for main, implement your solution in Python code and test it with a range of meaningful data. Remember that we've done the JCU grades question before, so copy your function from that practical code file. Sample Output Score: 3 Score: 50.5 Score: 66 Score: 100 Score 3.0, which is N Score 50.5, which is P Score 66.0, which is C Score 100.0, which is HD The average score was 54.875 Enhancements When you have that working... We asked for 4 scores. Have a look at your code... did you use 4 as a numeric literal or a constant?Change 4 to 3... Did you have to change the program in more than one place?If so, then you've missed one of the things we've taught...As a strong guideline: if you need to use the same literal more than once, you…short answers : c)Give an example of a common floating point arithmetic error due to the particular way in which floating point numbers are stored? d)Give an example of how when using C-strings and the functionstrcpy, things can go wrong.
- C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…C++ c ode. Write a program that prompts the user to input a string and outputs the string in uppercase letters. (Use a character array to store the string.)Q- Write a program which defines three integer variables, var1, var2 and var3, & initializing them to the values 100, 200 & 300, it then prints out their addresses. Subject: C++