What is the term applied to the trinucleotide shown by the arrow? 5' AU Ру AGGCC G C G G G ACCACCUGe |||||
Q: bisphosphoglycerate mutase is an example of Select one: a. transferase b. lyase c. none d. isomerase
A: The enzyme bisphosphoglycerate mutase is responsible for the synthesis of 2,3-bisphosphoglycerate fr...
Q: In one sentence each, how are the following bonds formed and broken in biomolecules? a) ester bond...
A: There are many types of covalent bond common in biomolecules. C-C bonds are basic to all organic mol...
Q: Why are some pathogens more noticeable than others?
A: A pathogen is an organism that causes disease in its host, with virulence referring to the intensity...
Q: QUESTION 10 In amino acids, D- or L- system is applied to (or determined from) O All amino acids are...
A: Amino acids are organic molecules composed of carbon, hydrogen, oxygen, nitrogen, and sulfur (only f...
Q: Read through each scenario. Under the scenario, write which lab safety rule is being broken and indi...
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first 3...
Q: Prokaryotic cells are very small and appear to be restricted in terms of their size, but eukaryotic ...
A: A prokaryotic cells ranges in size from 0.1 to 5.0 micrometers in diameter. An eukaryotic cells are ...
Q: Suppose a mutant Fatty Acid synthase only synthesizes a FA 14 Carbons long. How many ATP will the sy...
A: Acetyl CoA is a hybrid molecule that is involved in a variety of metabolic processes in the body. As...
Q: Abs undiluted 0.208 Diluted (1/10) 0.105 Diluted (1/20) 0.09 Use the chart above to back calculate...
A: Absorption spectroscopy is a spectroscopic method that measure the absorption of radiation by the sa...
Q: discuss the implications of having a good culture medium for the diagnosis of plant diseases?
A: Plant diseases are caused by different reasons ranging from pest infestations till waterlogged roots...
Q: Define micelle
A: The plasma membrane of cell or cell organelles is composed of the lipid bilayer. The lipid bilayer i...
Q: what is the parent shape of the molecule called
A: Electron groups around the central atom will be stable when they are as far apart as possible and we...
Q: What conditions could result in the degradation of oils and fats during storage?
A: Lipids are macromolecules that are made up of carbon, hydrogen, and oxygen just like carbohydrates b...
Q: How do you prepare 50 ml of 20 mg/ml proteinase K from 50 mg/ml stock solution
A: Proteinase K is a serine proteinase enzyme used to digest proteins. It is produced from a mold(fungu...
Q: 3. A patient has got excess carbohydrate meal for the years and gain the weight. To explain this: a)...
A: A.) SCHEME OF TAG SYNTHESIS IN LIVER
Q: Define active site
A: The enzymes speed up the reaction by several folds. Enzymes play a critical role in living systems. ...
Q: 1 0.8 0.6 Mutant y 0.4 Wild-Type 0.2 40 60 80 [ligand] 20
A: According to the given information, the wild type protein structure has aspartate in its primary str...
Q: I. Name the following carbohydrates using the proper way of naming/IUPAC system. a. Erythrose b. Lyx...
A: Carbohydrates are the primary source of energy for the body. Glucose is the simplest form of carbohy...
Q: I. Name the following carbohydrates using the proper way of naming/IUPAC system. a. Erythrose b. Lyx...
A: Since there are 3 questions asked, we will solve the first question. If you need the solutions of th...
Q: One of the most glaring difference between red and white wines is that red wines....... Select one:...
A: White wine : synthesized with white grapes, and the skin gets separated from juice prior to the ferm...
Q: Which of the following has the highest iodine content? Which of the following has the lowest meltin...
A: 1. Linoleic acid has the highest iodine content. 2. Unsaturated fatty acids have lower melting poin...
Q: 8 How can changes in the time delay of the feedback in a biological amplifier change the response of...
A: Hi! Thank you for the question. We are authorized to answer only one question at a time, since you h...
Q: If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the pho...
A: Here in question, I believe “a” side in Phosphodiester bond refer to the side bond to 3’-C atom of t...
Q: Prepare 5 liters of a 0.2 M dextrose solution using 5 liters of 5 M dextrose.
A: The equation used to make dilute solutions from the concentrated stock solution is as follows, C1V1=...
Q: Each of the following statements concerning mitochondria is true, EXCEPT a.The mitochondria require...
A:
Q: 10 samples of genetically modified organisms ( Animals ) With brief descriptions of each
A: Genetically modified organisms (GMOs) are those organisms (plants, animals or microorganisms) whose ...
Q: To which class of enzymes does each of the following belong?
A: Enzyme classification in needed to name the enzymes. According to the Enzyme Commission there are si...
Q: Explain Koch’s Postulates and the proof of pathogenicity.
A: German Physician in 1890 proposed criteria to identify a pathogenic bacterium which is known as Koch...
Q: 1. What is the name we give to structures which are not complete polypeptide chains but form superse...
A: "Since you have asked multiple questions, we will solve the first four questions for you. If you wan...
Q: Propose one amino acid substitution that would disrupt the leucine zipper structure and explain why
A: Leucine zipper structure is formed by leucine residues and these leucine residues are held together ...
Q: Which of the following is correct regarding nucleotide structure? Removal of the ribose-phosphate...
A: A nucleotides are the basic building blocks of nucleic acids (RNA or DNA).
Q: Proteins, nucleic acids, lipids, and carbohydrates are based on which element? охудen carbon hydroge...
A: Proteins are the linear chains of amino acids attached together via peptide bonds, Carbohydrates are...
Q: Illustrate different types of lipids and relate their chemical structures to their role in the bioch...
A: Lipids are important to our body as they store energy, as well as they are required for cellular str...
Q: What are the disadvantages of using genetic engineering to obtain resistant plants?
A: The new genetic material (DNA and genes) has been transfecting or reprogramming cultured ce...
Q: 2. Circle & Name functional groups -C-N, H. CH2 но CH H,C CH, HICICI
A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other element...
Q: Which of the following is cytidine? cytosine + guanine ribose + cytosine + phosphate group ...
A: Cytidine is a nucleoside monomer formed when a cytosine gets attached to a ribose sugar via a glycos...
Q: Which of the following cells is solely dependent on glucose as energy source? Muscle cells Kidney ce...
A: Inside the body, varying energy sources get exploited by different cells of various organs and tissu...
Q: is an example for aldotriose.
A: The question is about the functional group that out of given example which is the example of aldotri...
Q: Which of the following statements is true of double stranded DNA? The chains have a backbone of l...
A: Double helix (double stranded helix) is the structure of a DNA molecule.
Q: Chemistry Answer the following questions about hemoglobin. The number of high affinity binding sites...
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since ...
Q: Starting from formaldehyde, ammonia, hydrogen cyanide, carbon dioxide, ethene and water as needed, s...
A: 4.5 billion years ago our planate originate from the solar system. at 1st billion years, there is...
Q: The change in a single amino acid in protein result in Mutation O Genetic Code O Polymerization O Re...
A: Change in Single amino acid in a protein can change the protein structure and function.
Q: Explain how PEMBA is used to isolate, differentiate and enumerate Bacillus cereus from food sample.
A: Microscopic organisms such as bacteria, fungi (mold and yeast), protists, archaea, alga...
Q: how do proteins fold and unfold?
A: Protein folding :- a process by which a polypeptide chain folds to become a biologically active pro...
Q: What would cause our red blood cells to produce 2,3-diphosphoglycerate? Select 2 correct answer(...
A: Erythrocyte 2,3-DPG helps haemoglobin oxygenation by binding to deoxyhemoglobin and facilitating oxy...
Q: 3. The compound trypsin is a digestive enzyme produced by the pancreas. Enzymes are biological catal...
A: Enzymes are proteins facilitating various chemical reactions. They increase the rate of chemical rea...
Q: How are blood glucose concentration affected by heavy alcohol consumption? Please explain with extre...
A: Alcohol plays major role on health. Alcohol can effect every organ of the body. In an average person...
Q: The allosteric inhibitor of an 1 poi enzyme . Causes the enzyme to work faster O Binds to the active...
A: Answer The allosteric inhibitor of an enzyme participates in feedback regulation.
Q: Order the following choices to indicate the sequence of steps in the process of elongation of a grow...
A: The process of translation involves the synthesis of polypeptide chain and proceeds in three stages:...
Q: Enzyme hydrolysis of glucose-6-sulfate occurs in a marine microorganism. The activity test is based ...
A: Given: KM = 6.7 x 10-9 , Vmax= 300 nM min-1 = 300 x 10-9 m/ min-1, Substrate = 2 x 10-5 M Velocity =...
Q: Classify the carbohydrates below based on their carbonyl functional group (aldoses and ketoses) and ...
A: A biomolecule is a molecule that is produced by cells or living creatures. Carbohydrates, proteins, ...
Step by step
Solved in 2 steps
- a) what si the nucleotide at the 5 prime end of the picture? b) what si the DNA sequence from 5 prime to 3 prime pls help, urgently required, no explanation neededwol for Frayon Elolog - Meet - cha-gX-m sc Jupiter Ed G Which orgerell= A sample of DNA is collected from an organism. It is analyzed and determined that 20% of the DNA is made up of the base adenine. Based on this information, which of the following correctly lists the amounts of the three. remaining bases for this sample? 10% cytosine, 30% thymine, 40% guanine O 20% cytosine, 20% thymine, 20% guanine 30% cytosine, 30% thymine, 20% guanine 30% cytosine, 20% thymine, 30% guanine p. 5 of 31This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
- TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT Write the amino acid sequence of the protein that would be formed by translating this plece of DNA. You can use the three letter abbreviations for the amino acid in each box, do not use the name of the full amino acids, Use the abbrevlation of the amino adid exactly as Itswritten in the table (including the appropriate capltalizations For example it your answer for amino acid 1 is"Methionine" you would write MET in the box (not Met or met) Second Later UUU UUUC Phe UCU UAU Ser UAC UAA UAG Tyr UGU Cys U Leu UCA ucG UGC Stop uGA Beop UUG Step UGG Trp G Cuu C cuC CUA CUG CU Leu Coc CCA CG CAU Pro cGu CAC CAA CAG His CGC Arg CGA CGG 1st 3rd letter AUU A AUG AUA AUG ACU le AAU AAC AGU ACC Asn Ser U leBer ACC ACA Mct ACG The AAA AAG ACA Lys AGG Arg acu Val GCC GCA GCG GAU GAC GAA GAG GOU GGC GGA GGG Arp G GUC GUA GUG Ala Gly Glu Seovence of the protein, 1st amino acid. 2nd arnino acid: 3rd amino acid: 4th amino acid Sth amino acid: 6th amino acid: 7th amino…5' G-A-T-A-с-А-А-с-А-т-G-6-A-с-А-т-G-А-с-т3 What would be the first 3 bases in the 5' end of the complementary strand? Indicate the base sequence and the direction of synthesis of a 3-nucleotide RNA primer. Indicate the base sequence and the direction of synthesis of a 5-nucleotide Okazaki fragment (include a 3 nucleotide RNA primer, a total of 8 bases in the sequence). Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair and G-C base pair?Name the following nucleotide.
- What is thee tRNA anticodon for the first 5’-ACGAUC-3’?Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will travel the furthest? BAM HI: GGATCC CCTAGG AATCGGATCCATTTGGACTAAAGGACCCGGATTGGATCCAGGGCCTTTAGTACC TTAGCCTAGGTAAACCTGATTTCCTGGGCCTAACCTAGGTCCCGGAAATCATGG O 3 O 2 4. 1.Which forward are reverse primers will amplify the following sequence by PCR? 5' GACCTCGCCGACGCCCTCGACCAGCTCCTGCGCCGCACCCGCCACCTCGCCGAGACC GAGCAGAAAACCCGCCGTCGGAGAGCCACCCGCTCCGGTACGGCAGCACAGTTGCCCGA TCTTCCAGGCCAGCGGCGCCCATTCGACGCAGAGACCGCACCGGCCCCGGCACCGGACT GGAGCGAGAGCCTGGACGACCTCATCAGCGTCGACACGGCGGCCCAGACCGGCACGAGC GAGATGGAGGGCGCGAGCGTGCCGCCGGCCGAGGCAGGCGGGTACGGGCTGTGGGACGC CGAAGCGGAAGCCGAGCAATGGTGAACGCCTCACCGGGCACGAGCGATACGCCGGG 3'