What new amino acids might be substituted for proline after treatment with 5-BUDR? (This mutagen substitutes for thymine and causes T --> C and A --> G mutations.) Group of answer choices his, cys leu, ser arg, tyr no changes lys, gly

What new amino acids might be substituted for proline after treatment with 5-BUDR? (This mutagen substitutes for thymine and causes T --> C and A --> G mutations.) Group of answer choices his, cys leu, ser arg, tyr no changes lys, gly

Name: What new amino acids might be substituted for proline after treatment
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: What new amino acids might be substituted for proline after treatment with 5-BUDR? (This mutagen substitutes for thymine and causes T --> C and A --> G mutations.)Group of answer choiceshis, cysleu, serarg, tyrno changeslys, gly

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 9QP: Define and compare the following types of nucleotide substitutions. Which is likely to cause the...

See similar textbooks

Similar questions

Sickle-cell hemoglobin differs from regular hemoglobin in just one amino acid. Normal hemoglobin is created from the codon GAA, which codes for glutamic acid while sickle-cell hemoglobin has the codon GUA, which codes for valine. This is an example of what type of mutation? * O Insertion O Silent mutation O Deletion O Substitution mutation
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertion
Sickle cell hemoglobin DNA CACGTAGACTGAGG ACAC.. Sickle cell hemoglobin MRNA Sickle cell hemoglobin AA sequence 4. What type of mutation is this? Please explain why.
an a missense mutation of proline to histidine be made with a G • C → A • T transition-causing mutagen? What about a proline-to-serine missense mutation?
O The lac operon in E.coli encodes enzymes necessary for the breakdown of lactose. For each enzyme (lac Z and lac Y), indicate with a + or-whether or not it is made when there is no lactose or when there is lactose. B-galactosidase (lac Z) No Lactose Permease (lac Y) Lactose Lactose No Lactose Genotype PP0 Z Y/I P*O*Z•Y* I'POCZ Y*/I P* O©Z*Y° P O Z'Y/I P'OʻZ'Y* PP O ZY*/IP*O*Z*Y* IP OCZ Y /I P*O*Z•Y* IPO ZY*/I* P*O©Z*Y• I'PO*Z Y*/IP'O*Z*Y°
TRANSLATE this RNA sequence: AUGCAAUGA Met-Gln-Stop Met-His-Stop Thr-Glu-Stop Thr-Pro-Stop What would happen if the nitrogen base second to the last of the sequence will undergo a point mutation, (G turning to A) Met-Gin-Stop Met-His-Stop Thr-Glu-Stop Thr-Pro-Stop The DNA sequence ATCAGCGCTGGC is part of a gene. how many amino acids are coded for by this message? O 4 8. 12 20 Option 5 For the lab part: how is DNA used for catching crime suspects. Describe the procedure and cite a particular example where it helped solve a case or absolved an innocent person from any wrongdoing. Your answer O O
When considering the mutational options for a nucleotide such as thymine, there is a single transition and two transversion type mutations that are possible, which is why we observe transversions to occur more frequently in nature when genomes are examined. O True O False
An individual carries a somatic mutation that changes a lysinecodon into a glutamic acid codon. Prior to acquiring this mutation,the individual had been exposed to UV light, proflavin, and5-bromouracil. Which of these three agents would be the mostlikely to have caused this somatic mutation? Explain your answer.
Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the fragments generated with each treatment. Determine the original sequence for both fragmentations (reduerde that they must be equal in the order of amino acids) Quimotripsina 1. Leu-His-Lys-Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly-Pro-Ser 1. Gln-Gln-Ala-Gln-His-Leu-Arg-Ala-Cys-Gln-Gln-Trp 2. Arg-lle-Pro-Lys-Cys-Arg-Lys-Phe Trypsin 1. Arg 2. Ala-Cys-Gln-GIn-Trp-Leu-His-Lys 3. Cys-Arg 4. Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly- Pro-Ser 5. lle-Pro-Lys 6. Light 7. Phe-Gin-Gln-Ala-Gln-His-Leu-Arg
G T-A what's called a FRAMESHIFT mutation, meaning the reading "frame" čhanging the amino acid sequence from this point forward G-Cc A-u SUBSTITUTION (one base is substituted for another) --- If a substitution changes the amino acid, it's called a MISSENSE mutation --- If a substitution does not change the amino acid, it's called a SILENT mutation --- If a substitution changes the amino acid to a "stop." it's called a NONSENSE mutation Complete the boxes below. Classify each as Deletion, Insertion or Substitution AND as either frameshift, missense, silent or nonsense (Hint: Deletion & Insertion will always be frameshif Original DNA Sequence: TACA C C T T G G C G A CGAC T ... MRNA Sequence: Au GduGilAAdk GcuadiGA stait -TrP Pen-frg-cys stop Amino Acid Sequence: Mutated DNA Sequence #1 TA C»A(T C•T T G•G C GªA C G' A C T.. What's the mRNA sequence? AUGOUTAGOAAC•CECOUGIC•UEIA amino acid sequence? Will there likely be effects? yes (Circle th metootop What type of mutation is this? NONSense…
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing