Q: Tell me how this image shows the relation between grape and banana
A: A phylogenetic tree's branching structure illustrates how many species or other groupings developed…
Q: 5. › Polyphenoloxidase is involved in the darkening of wheat products due to its oxidative effect on…
A: Enzymes are biocatalysts which increase the rate of chemical reaction by decreasing the activation…
Q: QUESTIONS 1. Using a reference, find the function of simple cuboidal epithelial tissue in humans and…
A: Simple cuboidal epithelium is a type of epithelium that consists of a single layer of cuboidal…
Q: 1. You are a lead engineer in a cGMP facility that develops and delivers tissue engineering…
A: Globally, myocardial infarction (MI) is one of the leading causes of death. Loss of cardiomyocytes,…
Q: 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac…
A: Annotating a genome involves finding functional components throughout its sequence in order to give…
Q: The frequency of the Z allele in a population of 2000 diploid turtles is 0.2. 250 turtles from a…
A: Allele frequency refers to that how common an allele is present in a population.
Q: Chloroplast genomes have sequence homology to cyanobacteria genomes. (True or false)
A: Sequence homology is a concept used in molecular biology and biochemistry to describe the degree of…
Q: Urianalysis- Need help understanding what is happening?
A: Question : Urianalysis - Need help understanding what is happening ? Answer : Urianalysis is the…
Q: Describe Scientific Method
A: A research proposal is a document that specifies the aims of the research and the techniques that…
Q: Relaman has suffered from high fever and Doctor diagnosed it as Typhoid which microorganism infected…
A: Typhoid It is an infection that spreads through the consumption of contaminated food and water.…
Q: The amount of sodium in Bowman's capsule can be doubled by: O A. Doubling of glomerular hydrostatic…
A: Introduction The Bowman's capsule, a component of the nephron, creates a sack that resembles a cup…
Q: A 55 year old man who is overweight, a heavy drinker and habitual smoker is brought in to the…
A: When choosing an imaging modslity for detection of ischemic stroke, there are two choices, magnetic…
Q: Explain why infections caused by fungi, protozoans, and helminths are more difficult to treat than…
A: Introduction : Infection is the entry of the pathogen or infectious agent that causes the disease…
Q: Background: There are ten major phyla that represent the invertebrate animals. Though they all share…
A: The answer is not based on the lesson you have mentioned but the answer is from general knowledge.…
Q: The principles of biomimicry and bioinspiration have been used to design and to engineer…
A: To cope with the complexity of the body and to evade the multiple layers of defense that tissues and…
Q: do strawberry and raspberry fall under the category of eudicots
A: The eudicots, also known as eudicotyledons, are a group of flowering plants that are primarily…
Q: A total of 2.5 x 105 cells were harvested from the patient. You need the cells to fill a scaffold…
A: The growth or culturing of cells obtained from different sources such as humans, animals, or plants…
Q: What is the general function of the structure labeled A? Convert the incoming sound from pounds…
A: Ear is the sensory organ which help in hearing and balance maintanence Ear is divided into three…
Q: The functions of almost all of the genes in the lambda genome were first explored using mutations.…
A: Lambda is a bacteriophage virus capable of infecting of bacteria. The mature virus particle consists…
Q: The major issue associated with the use of live, attenuated virus for vaccines is _____. A)…
A: ANSWER) The use of live attenuated virus for vaccines is not recommended as the attenuated virus can…
Q: DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC…
A: One of the core concepts of molecular biology is the flow of information from DNA to RNA to…
Q: .What is biomass as a source of energy? Is it considered as renewable source of energy?
A: Biomass energy is the energy which is generated by using living mass. Biomass is a renewable energy…
Q: Use the Chain of Infection to describe Legionnaire’s disease
A: Introduction Legionnaire’s disease it is type of pneumonia caused by legionella bacteria. lung…
Q: How many ATP molecules are overall produced in Glycolysis? 3 ATP 5 ATP 4 ATP 2 ATP
A: Question : How many ATP molecules are overall produced in Glycolysis ? Answer : 4 ATP molecules
Q: What are the specific roles of growth factors in a bacterium.
A: Growth factors are molecules naturally present in the body that stimulate cellular growth,…
Q: If I set up a Chi square analysis and determine that I cannot reject the null hypothesis based on my…
A: When the sample sizes are large, a chi-squared test is a statistical hypothesis test used in the…
Q: O Cats O Dogs O Elephants O Humans O Spiders (like Charlotte in Charlotte's Web)
A: Semelparity is a type of reproductive technique. It is opposite of iteroparity.
Q: 4. Describe what happens when a nonsense mutation is introduced into the gene encoding transposase…
A: Mutations are sudden changes to the DNA sequence of an organism that is the result of errors during…
Q: What are the processes in order for a biomass become a useful.source of energy. Outline/ illustrate…
A: Biomass the amount of organic matter present in the plants or animals. This biomass can be utilized…
Q: If you are going to construct a cDNA library of a plant,will the cDNA library be the same as those…
A: Instead of starting with DNA, mRNA is used to create cDNA libraries. Messenger RNA transports DNA's…
Q: How to measure the muscle strength and muscle mass by using the anthropometric assessment
A: Anthropometric measurements provides the quantitative measurements of the body. This assess the…
Q: Can nanomaterials in smart packaging be used to monitor food fermentation? subject:
A: Nanomaterials can be used as a food additive or nutritional carrier in food packaging, as well as a…
Q: Describe the difference between the terms INFECTION and DISEASE. Starting with exposure to…
A: Pathogens are essentially any germ or organism that lives in the bloodstream of an infected person…
Q: Which of the following genotypes should be considered "true breeding"? 1.) AaBB 2.) AaBb 3.) aaBB…
A: Genotypes It refers to the set of genes possessed by an organism. It describes the variant forms of…
Q: Instructions Explain 1 way each of the following can occur. In your answer, say whether non-…
A: the sperm carries Y, so non-disjunction occurs in mother, If the X chromosomes failed to separate…
Q: ad this story and identify the different aspects of the scientific method by choosing the Cement…
A: In order to prove something scientifically one conducts experiment on the basis of the observations.…
Q: STRETCH BAND LATERAL RAISES Bones Muscles Joint type(s) Movement(s) Name an activity you could do in…
A: Your breathing and heart rate will increase during endurance or aerobic exercises. They enhance your…
Q: Antibodies are found: O OOOO in the blood plasma on white blood cells in fibrinogen on red blood…
A: Antibodies are the proteins molecules that are synthesized by the B cells in the blood in response…
Q: if you replaced the hox genes that are normally expressed in a dolphin fin with the hox genes that…
A: Gene expression is predominantly regulated at the transcriptional level, owing to protein binding to…
Q: 5. A patient receives a donor kidney to replace diseased kidney tissue. Consider and answer the…
A: In a kidney transplant, a healthy kidney from a living or deceased donor is surgically implanted…
Q: How many Illumina clusters would you need to generate 15X coverage of the human genome, assuming…
A: Formula: C=LNG C stands for coverage G is the haploid genome length L is the read length N is the…
Q: 4.08 2.54 H Note: E E 1.02 1.02 1.67 H = EXON = INTRON AE E 10.8 kbp 3.94 3.66 E = EcoRI site H =…
A: Autoradiography is a method that visualizes molecules or fragments of molecules that have been…
Q: 1.Where will a bacteria grow best: glucose, malonate, or gluconate? Explain your answer…
A: Culture media is a gel or liquid that contains nutrients and is used to grow bacteria or…
Q: The HIV Virus The virus particle is spherical in shape. Its structure consists of multiple enclosed…
A: Human immuno deficiency virus (HIV) is primarily a RNA virus. It causes AIDS which is a chronic…
Q: In low to middle-income countries, the risks of disease from environmental factors are high for…
A: Low- and middle-income nations bear a disproportionately large portion of the burden of diseases…
Q: Explain the comercial scale of the gros michel banana
A: The commercial scale of the Gros Michel banana was very large. It was one of the most popular and…
Q: Site of transcription Choose a match
A: All of the given matches are correct but Transcription takes place in the nucleus. An RNA…
Q: A 55 year old man who is overweight, a heavy drinker and habitual smoker is brought in to the…
A: Stroke : A obstruction in the blood supply to the brain or the rupture and bleeding of a blood…
Q: buttressing system. Different skull functions show species developments. What different activities…
A: Ho.o habilis and homo erectus were archaic humans. Homo habilis lived around 2.4 million years ago…
Q: For each experimental set up (geotropism and phototropism), identify the dependent and independent…
A: In an experiment the independent variable is the cause and the dependent variable is the effect. The…
What role does the environment play in addressing the needs of society?
Step by step
Solved in 2 steps
- Should the environment be treated as a person? If so, why? If not, why not? (If your answer is that the environment should be treated as a person, then you think we have moral obligations toward it.)What does the study of ethics encompass? Describe and differentiate instrumental value and intrinsic value. What is environmental ethics?In what ways does affluence affect the natural environment compared to how poverty affects the natural environment?
- Humans play a significant role in society and in the environment. As a product of the previous generation, how can you contribute in improving our society for the benefit of the next generation?How can we use the principles of biology to improve human welfare, and how can we live our lives in ways that control our impact on the world around us?what are examples of social networks use for fostering political and social movements; for their use in health care, among doctors, patients, physicians, professional groups, or enthusiasts? how can social networks be used effectively, or what are the risks?