Whenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?

Whenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?

Name: Whenever a person consumes dairy products, they utilize lactase enzyme
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Whenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA s

An Illustrated Guide To Vet Med Term

4th Edition

ISBN:9781305465763

Author:ROMICH

Publisher:ROMICH

Chapter2: Where, Why, And What

Section: Chapter Questions

Problem 3CP

See similar textbooks

Similar questions

Permethylation followed by hydrolysis of one lactose molecule leads to the formation of: A 2, 3, 4, 6 tetra O methyl galactose and 1, 2, 3, 6 tetra O methyl glucose; B| 1, 3, 6 tri 0 methyl glucose and 2, 3, 6 tri O methyl galactose; C 1, 3, 6 tri o methyl galactose and 2, 3, 6 tri O methyl glucose; D 2, 3, 4, 6 tetra O methyl glucose and 1, 2, 3, 6 tetra O methyl galactose; E none of the above answers is correct.
Use the following information to answer the next question. The DNA strand shown below is thought to contain the genetic code for part of an enzyme B-galactosidase which is involved in lactose metabolism. (Read the DNA beginning at the left.) -A-T-A-T-G-G-G-G-C-A-T-G The second amino acid coded from the section of DNA for B-galactosidase is Select one: a. thymine b. tryptophan c. serine d. threonine
Explain what happens to milk proteins during the formation of yogurt. (HInt: yogurt is made by fermentation of milk by bacteria, typically Lactobacillus bulgaricus and Streptococcus thermophillus. The bacteria convert milk sugar to lactic acid.)
Define the following terms: a. enterocyte b. N-glycan c. O-glycan d. glycogen e. glycosaminoglycan
Lactose intolerance is caused by reduced production of the enzyme lactase. A variety of digestive system problems, such as celiac disease and Crohn’s disease) can also lower the production of lactase. If an individual produces low levels of the enzyme lactase, explain why they might be able to tolerate eating dairy products that contain lower levels of lactose (e.g., hard cheeses, feta cheese, and cottage cheese), but will not be able to tolerate foods with high levels of lactose (e.g., milk).
Lactose is found in milk products. It is converted by the body into a usable form in a series of chemical reactions. The diagram shows the series of reactions that convert lactose into a usable form. Enzyme 1 Enzyme 2 Enzyme 3 Enzyme 4 galactose- 1-phosphate Lactose galactose glucose- 1-phosphate glucose- 6-phosphate If enzyme 2 is denatured (destroyed), the levels of which substance will increase?
Ñame the specific molecules that are produced when sucrose is broken down
Lactose in milk is hydrolyzed, absorbed through the intestines, and then utilized for energy metabolism. Oligosaccharides that are not hydrolyzed in the digestive tract cannot be absorbed nor used for energy. Choose the best explanation for why these oligosaccharides would be necessary in human milk (or infant formula). A) These oligosaccharides prevent weight gain in infants. B) These oligosaccharides absorb excess energy, allowing infants to sleep. C) These oligosaccharides train the digestive tract to tolerate high levels of sugars, necessary for a typical adult American diet. D) These oligosaccharides provide fiber and prevent constipation.
Compare the total carbohydrate (polysaccharides + fiber+ sugars) and sugar (disaccharides and monosaccharides) content of 2% Lactaid vs. 2% regular milk (both pictured). Are they the same or different? Why?
the available answer choices for each blank are: -3 glucose -Fructose, glucose -Glucose, maltose, isomaltose, alpha-limit dextrins -Galactose, glucose -Glucose, maltose, maltotriose, dextrins 2 glucose -Glucose, maltose, maltotriose
Explain the Formation of the disaccharides lactose and sucrose.
John has been living in an apartment all junior year, eating a lot of fast food. He has heard that it is "bad for you" because it is too high in calories and too low in essential nutrients, particularly vitamin A. John looks up the nutrient composition of two of his favorite fast-food meals (see table). 1. If John chooses the Big Mac, fries, and soda, for lunch, how many micrograms of vitamin A would he be consuming? (Hint: You first need to convert % Daily Value to micrograms of vitamin A.) Vitamin A Energy (% Daily Value) (kcal) McDonald's Big Mac 540 Medium fries 380 0.2 oda (20 oz) 240 KFC Fried chicken thigh and breast 690 2.6 Mashed potatoes and gravy 120 1.5 Soda (20 oz) 240 *Hint: first you need to look-up the daily Value for vitamin A: 900 µg (I just gave you the Daily Value). For dinner, John has 2 cups of spaghetti with meat sauce, a slice of Italian bread with 1 tsp butter, and a cup of 1% milk. 2. How much vitamin A does this provide? (use iProfile to for this solution) 3.…