Which of the candidate genes would be good targets to develop potential therapeutics using SİRNA (Hint: you might want to go back and review RNAI interference lecture 10B). For which of these genes is SİRNAI treatment good strategy for cancer therapy. SIRNA is a technique that targets and degrades gene specific RNAS. A) p53 B) cyclin D C) Muts also MSH2/6 D) ras E) let-7 F) telomerase
Q: List five types of cancer in which ncRNAs can be involved.
A: Non-coding RNA (ncRNA) is an RNA molecule that is not translated into a protein. Epigenetic related…
Q: E30. An electrophoretic mobility shift assay can be used to study the binding of proteins to a…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Explain and give examples of Inducible & Repressible Operons. Describe what types of protein…
A: Inducer: Inducer is the substance that causes the gene for protein synthesis to be activated.…
Q: The in situ hybridization method is based on Select one: a. labeling specific neuronal components…
A: Hybridization is the property of single-stranded nucleic acids to base-pair with their complementary…
Q: Proto-oncogenes can be converted to oncogenes in a number of different ways. In some cases, the…
A: Cancer is a disease that is associated with uncontrolled division of cells and invasion of…
Q: How might genomic information be helpful for the effective use of imatinib mesylate (Gleevec) in…
A: Imatinib mesylate is a drug used for the treatment of myeloid leukemia that is caused due to…
Q: seems that the expert only addressed the background of prorooncogen and the impact of Ras causing…
A: Protooncogenes are the genes that form the proteins that are responsible for cell division and cell…
Q: Can you explain what exactly operon is? Instead of just copying and pasting from google, can you…
A: DNA DNA are the inheritable unite which passes from parents to their offsprings. DNA contains genes…
Q: The amino acid asparagine is synthesized from aspartic acid by the enzyme asparagine synthetase…
A: Mutation has occurred in the regulatory sequence present upstream of genes. Since the regulatory…
Q: Propose a strategy to prevent HIF-alpha signaling in the TME. What do you think would happen in a…
A: The oxygen-sensitive transcriptional activator HIF-1 (hypoxia-inducible factor-1) is an important…
Q: a) In an experiment, you have changed a DNA sequence directly upstream from a start codon of an…
A: The question says that transcription is not affected but translation is. Therefore, some sequence…
Q: e previous problem you proposed a model for how this gene could be regulated. Suppose that you carry…
A: If the mutation is recessive mutant then there should be mutation in both allele to see this effect.…
Q: Bacteriophage lambda is as one of the routinely used molecular cloning vectors, which also served as…
A:
Q: During experimental RNAi, how does the researcher affect expression of a target gene? Group of…
A: Introduction: In the process of RNA interference(RNAi) double-stranded RNA molecule suppresses the…
Q: Propose some specific uses of a modified CRISPR-Cas system as a general RNA-guided device for…
A: CRISPR (Clustered regularly interspaced short palindromic repeats)-Cas is a gene-editing tool. It…
Q: Which of the following statements is/are TRUE for the promoters? The Pribnow box and TATA box are…
A: A promoter is a short region of DNA upstream of gene where RNA Polymerase recognizes the start site…
Q: What functional information about a genome can be determined through applications of chromatin…
A: Chromatin Immunoprecipitation (ChIP) is a type of technique based on immunoprecipitation and is…
Q: 1. Contents of the diagram below was discovered in the 1960s. Explain in detail what this diagram is…
A: Transcription is defined as the process by which the information present in a strand of DNA will be…
Q: A more thoughtful analysis of NANOG expression should consider all post-transcriptional and…
A: Medical experts continue to find new medications that aid in the treatment of deadly diseases and…
Q: Explain the CRISPR-Cas Mechanism for RNA-Guided Destruction of Invading DNA ?
A: CRISPR or clustered regularly interspaced short palindromic repeats denotes a set of sequences of…
Q: What is o A vector derived from the tumor-inducing (Ti) plasmid of the bacterium Agrobacterium…
A: In recombinant technology, vectors are the DNA molecules that are used as a vehicle which carry…
Q: ptoph had a mutation on the repressor, not allowing it to bind with tryptophan. The repressor is…
A: Operons are proteins encoded together as a block that performs specific functions and are involved…
Q: . What is the function of operons in bacterial gene regulation? b. Describe how a bacterial…
A: a. What is the function of operons in bacterial gene regulation? b. Describe how a bacterial…
Q: The ability to selectively modify the genome in the mouse has revolutionized mouse genetics. Outline…
A: Molecular biology's applications include the development of new protein products, illness prevention…
Q: How will this modified cro protein interact with the three OR sites, and how would cro expression be…
A: Bacteriophages are viruses that infect bacteria. Like other viruses bacteriophages are also made up…
Q: Bacteria are often the preferred hosts for splicing in novel genes. For instance, the gene for human…
A: "Biotechnology" is the use of our knowledge of biological processes for the development of…
Q: ou have isolated different mutants (reg1 and reg2) causing constitutive expression of the emu operon…
A: The operon's regulation can take place positively or negatively. If the negative operator is bound…
Q: What will most likely happen when the -35 element and pribnow box are mutated? a. The sigma factor…
A: -35 element and pribnow box both act as the essential part of the promoter sequence for DNA…
Q: ou were tasked to develop two types of vaccines: a DNA vaccine and a protein subunit vaccine. For…
A: Recombinant DNA Vaccine : Live attenuated vaccine : These are the vaccines where whole bacteria or…
Q: Suppose you cultured yeast, that you had transformed with pMZ379 plus the AVT5 sgRNA, on a plate of…
A: Cas9 is a kind of enzyme. That functions as a pair of'molecular scissors,' allowing portions of DNA…
Q: Which of the following accurately describes the function of HOTAIR? O It is a long non-coding RNA…
A: Option 1 is the correct answer.
Q: Describe in detail the process of RNAi including the major proteins involved. What is the role of…
A: Gene silencing is the process of suppression of expression of a gene at transcription or translation…
Q: i) Suppose we want to insert the GFP sequence after the promoter of a gene X to create a fusion…
A: The CRISPR Cas9 system is a tool for cutting a DNA at a particular location. This system has 2…
Q: When environmental conditions are optimized for promoting cellular growth, which statements are…
A: Bacteriophages are viruses which infect bacteria.They are obligate intracellular viruses.They have a…
Q: Q. Which of the following statements about CRISPR-Cas9 is correct? A. It relies on the natural…
A: CRISPR has now changed the way molecular biology is done.We can say that we have the ability to make…
Q: If glucose levels in the cell are high and lactose is available from the environment, what is the…
A: Bacteria such as E.coli has developed an outstanding system of genes that together regulate the…
Q: Yes or no only. rna seq can provide sequence and expression data do riboprobes synthesize bu in…
A: Rna seq can provide sequence and expression data : YES Single-cell RNA sequencing (scRNA-Seq)…
Q: Suppose you cultured yeast, that you had transformed with pMZ379 plus the AVT5 sgRNA, on a plate of…
A: sgRNA or single guide RNA is an abbreviation that expands as “single guide RNA.”…
Q: Propose some possible reasons why mutations in the RPSA gene affect only the spleen and not other…
A: Spleen is a small part present in the gastro intestinal tract of an individual. Spleen has some…
Q: How does one perform a Southern blot and how does one performs a western blot. What can a Southern…
A: Southern blotting is the procedure that requires the transfer of separated fragments of DNA (DNA) to…
Q: For each of the ff. scenario, state whether the gene is up- or down-regulated and briefly explain…
A: Up-regulation of gene expression refers to the increased expression of a gene by increasing the…
Q: The effect that cAMP has on CAP is that a. it causes LacI to bind a promoter. b. it causes CAP to…
A:
Q: Explain how the lac operon is regulated under the following conditions. Include the following terms…
A: Lactose can be broken down by E. coli bacteria, however, it is not their preferred fuel. They would…
Q: What is an operon ? a. A series of genes controlled by the same operator b. A series of genes on the…
A: Operons are the functioning unit of DNA that consists multiple genes grouped together with an…
Q: In the tryptophan operon, if the leader peptide is translated normally A region 2 will pair with…
A: Answer, In bacteria, an additional, mechanism termed transcriptional attenuation negatively…
Q: Mutations that occur in enhancer sequences would most likely affect the cell by ____. altering…
A: Transcription is a process by which the RNA is transcribed from the DNA sequence using RNA…
Q: RNAi: a) is a cellular defense system against viral replication b) involves dicer…
A: RNA stands for ribonucleic acid. It consists of ribonucleotide sub units.
Q: Describe a ChIP-Seq experiment that will enable the identification of promoters to which the…
A: The approach for the detection of connections between particular genomic regions and protein, in…
attached is the question
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- RNAi is currently being tested as a therapeutic tool for genetic diseases and other conditions. Consider the following: cystic fibrosis caused by loss of function of the CFTR gene, HIV infection, and cancer caused by hyperactivity of a growth factor receptor. Which of these may be treatable by RNAi, and which not? Explain your reasoning.1.) Which of the following would be a good chemotherapy approach: blocking formation of the ribonucleotide GTP or blocking formation of the deoxyribonucleotide dGTP? Why? Please explain the chemical differences between each of the two nucleotides. Use the specific processes below to support your choice by explaining how either GTP or dGTP are related to these and how loss of the particular molecule would affect each process. A.) PEP carboxykinase in gluconeogenesis B.) Succinyl-CoA synthetase in the TCA Cycle C.) Glucagon signal transductionPeptiDream has developed a technology to create cyclic peptides. Which of the following is TRUE about the technology they developed? O They adopted Antisense Technology to incorporate cyclic peptides to the antisense drug which has improved therapeutic effect. O They utilized HTPathwaySeq, which is an RNA-seq based drug screening platform to characterize therapeutic molecules including cyclic peptides O They combine the technology of mRNA display and Flexizyme to put an unnatural amino acid onto a tRNA which goes into the in vitro translation system O They took advantage of the SYNTHORUNTM Technology Platform, which expands the genetic code by adding a new DNA base pair in order to incorporate unnatural amino acid.
- In the treatment of acquired immunodeficiency syndrome (AIDS), a possible mode of therapy is to inhibit the reverse transcriptase (RT) of the human immunodeficiency virus (HIV), whcih is required for the retrovirus to be propogated by RNA-directed DNA synthesis. In the figure below, one of the substrates for RT is thymidine; and two drugs, AZT and HBY097 are known to inhibit HIV RT> (a) Thymidine; (b) AZT; (c) HBY097 Look at the structures and predict the type of inhibition (i.e. competitive or non-competitive) likely to be shown by each drug. By using knowledge on enzyme, plan an experiment that would enable you to confirm the type of inhibition by investigating enzyme kinetics and explain how you would interpret the results.Remarks: Not more than 250 words.Various antimicrobial drugs to treat microbial infection have diverse mechanism of action. Consider the following antimicrobial drugs: A. Seconeolitsine, known as DNA topoisomerase I inhibitor in bacteria. (i) Explain briefly how inhibiting DNA topoisomerase I is a good mechanism of action for an antibiotic, include possible molecular machineries being targeted. (ii) What would be an appropriate response if seconeolitsine works well by stating the state of supercoiling in bacteria. (iii) To prove your answer (ii), you test the condition of bacterial DNA by running gel electrophoresis, one has been treated with seconeolitsine (+ sample) and the other one is not (- sample). Explain the position of each + sample and – sample band on the gel in reference to the point of origin (where you load your samples) or how far each DNA sample travel across agarose gel. (iv) Explain why you would expect answer (iii) for each + sample and – sample. B.…How might genomic information be helpful for the effective use of imatinib mesylate (Gleevec) in cancer chemotherapy?
- the topic is Identification of Differentially Expressed Genes in Breast Cancer Using RNA-Seq write a method section of a scientific report for this topic. including the use of excel to get these result( will be included in the images) and also this website https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE21623897Which of the following is examples of a transposable element found in bacteria? (multiple choice questions)A.IS903b.Tn5c.IS1D.Xis 98What is the key component of the catalytic site of the spliceosome? (multiple choice questions)A.DNAb.ribosomesc.proteinD.RNA 99Which antibiotic can binds to RNA polymerase and blocks an early step in RNA synthesis?A.Ampicillinb.Chloramphenicolc.RimantidineD.None of the above 100All tRNA molecules have poly (A) tails at their 3' end. Yesorno1) Assuming that all the appropriate accessory proteins (switches) and RNA polymerase is presence, transcribe this gene i.e a) write out that sequence of the mRNA you will make from turning on this gene Z b) Label the 5' and 3' ends of the mRNA made 2) Assuming there is a ribosome binding site for the mRNA you just synthesized in the previous question, write out the amino acid sequence of this protein Z that is made (Using the genetic discord Mary provided) The following double stranded DNA sequence provided contains a gene for making proteins Z. The regulatory sequence or switch is indicated by the Red colored sequences. Start of transcription is 10 nucleotide after the switch sequence beginning at the Blue region. Answer the following questions. 3'. TATGACAACGCGTATAATCCAGTCGGTTTGGGGGTAATTGGGCGTCCTACGTCTACAAAGGGTCGTT ААТAGCATTTAGGCGTсTGCCTTTTAТCGTTTATCGAATTтсТТАТTАTTTTAATстCсT...5 5'.ATACTGTTGCGCATATTAGGTCAGCCAAACCCCCATTAACCCGCAGGATGCAGATGTTTCCCAGCAAT…
- FRNA processing events include A. self splicing B. methylation of 455 FRNA C. snoRNA facilitates methylation D. methyltransferases catalyze the methylation E. modification of some bases А) А, В, С only в) А, В, С, Е only с) А, В, С, D, E D B, C, D, E onlySeveral common antibiotics affect some strains of bacteria's ability to carry out transcription and/or translation. For example: Rifamycin inhibits prokaryotic RNA polymerase Chloramphenicol blocks the transfer of the peptide from the P to A site. a) For each of these drugs, identify at what point it could affect the process of DNA->RNA->protein. Be as specific as possible. b) Why do you think these drugs kill bacteria but spare animal cells? (Hint: remember bacteria are prokaryotes)The prospect of using gene therapy to alleviate genetic conditions is still a vision of the future. Gene therapy for adenosine deaminase deficiency has proved to be quite promising, but many obstacles remain to be overcome. Currently, the correction of human genetic defects is done using retroviruses as vectors. For this purpose, viral genes are removed from the retroviral genome, creating a vector capable of transferring human structural genes into sites on human chromosomes within target-tissue cells. Do you see any potential problems with inserting pieces of a retroviral genome into humans? If so, are there ways to combat or prevent these problems?