Which of the follow general transcription factors contains the protein TBP and binds to TATA box promoters first? Group of answer choices TFIID TFIIB TFIIA TFIIF
Q: Explain the reason as to why Hershey and Chase did not take carbon as radioisotope but 32р as the…
A: Hershey and Chase conducted their experiment on E. coli bacteria to determine the genetic material.…
Q: The scaffold will have islet beta cells encapsulated within it so how can radiopacity be used to…
A: 1. Placement Visualization:Radiopaque agents in the TPU enhance visibility during medical imaging,…
Q: Explain the reason as to why Hershey and Chase did not take carbon as radioisotope but 32р as the…
A: Harshey and Chase experiment was performed in 1952 and it's main aim was to confirm that DNA is the…
Q: Indicate the name and major function of each structure in the image. A B A D C ; E E D
A: The nervous system is a complex network of cells and tissues that is associated with the…
Q: Compare the location and structure of the epidermis, dermis, and subcutaneous tissues. if possible…
A: The epidermis is the outermost layer of the skin, providing a protective barrier against the…
Q: When Talia’s daughter isn’t feeling well before school, she gives her a spoon of honey that looks…
A: Delusional thinking is a phenomenon in which a person has particular views about something that are…
Q: What are proteins? explain in detail
A: The objective of this question is to understand what proteins are and their role in biological…
Q: What are olfactory receptors, olfactory sensory neurons, olfactory bulbs, and olfactory cortex?
A: The objective of the question is to understand the definitions and functions of olfactory receptors,…
Q: In corn plants, a dominant allele (1) inhibits the expression of kernel color, while the recessive…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Explain the important characteristics of dominance.
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: 1. What is the producer? 2. Identify the primary consumer(s): 3. Identify the secondary consumer(s):…
A: Ecosystem is the interaction between the organisms with their biotic and abiotic factors. In an…
Q: Determine the way in which sex-influenced and sex limited characteristics differ from sex-linked…
A: The autosomal genes encode sex-influenced traits and are expressed in only one sex. Autosomal genes…
Q: Explain the importance of the discovery of DNA structure.
A: The genetic material of organisms is considered to be DNA. The structure and functions of DNA are…
Q: Irene hurt her knee when she fell while learning a new snowboarding trick. She is already starting…
A: The process of communication from one neuron to the other involves the action of chemical…
Q: 20. The following diagram represents the homeostatic control of body temperature. What does the part…
A: Solution:- The correct option is 'b' i.e Hypothalamus.Explanation:- The hypothalamus acts as the…
Q: Compare and contrast these kidney: Kidney of amniotes and metanephros
A: Amniotes, including reptiles, birds, and mammals, have evolved kidneys that are adapted to their…
Q: Which of the following comparisons between the moss life cycle and fern life cycle are correct? A)…
A: The objective of the question is to identify the correct comparisons between the life cycles of…
Q: The term hypocotyl refers to the portion of the embryonic stem that is located below the attachment…
A: The objective of the question is to verify the definition of the term 'hypocotyl' in the context of…
Q: What would happen if you removed the shoot apical meristem of a plant?
A: The objective of the question is to understand the consequences of removing the shoot apical…
Q: Pick any fly in Hartford and answer these questions 1. what attracts them 2. what flys like and why…
A: Flies are winged insects belonging to the order Diptera. They have a single pair of functional wings…
Q: which biome is not likely to occur in a dry environment? grassland desert boreal forest tundra
A: The objective of the question is to identify the biome that is least likely to occur in a dry…
Q: Explain the importance of the discovery of DNA structure.
A: The genetic material of organisms is considered to be DNA. The structure and functions of DNA are…
Q: Which of these cells is NOT connective tissue? cartilage bone adipose (fat) blood O All of these are…
A: Connective tissue, as the name suggests, plays a crucial role in connecting, supporting, and…
Q: Determine the difficulties that occur in the diagnosis and treatment of cystic fibrosis, due to…
A: Cystic fibrosis (CF) is defined as a genetic disease which is inherited from the parents. In this…
Q: M G1 G2 G3 G4 G5 G6 G7 G8
A: The DNA ladder (M) shows a series of bands at known sizes which serve as a benchmark to determine…
Q: How does a pollinator actually pollinate? What specific pollinators do we have in Connecticut?
A: Pollination is the process by which pollen is transferred from the male reproductive organs…
Q: One difference between sieve-tube cells and vessel elements is that sieve-tube cells are ________,…
A: The question is asking for a characteristic of sieve-tube cells that differentiates them from vessel…
Q: A biologist is trying to classify an organism on the basis of the fact that they undergo sexual…
A: The objective of the question is to identify the correct group of fungi to which the described…
Q: The following cross is conducted between varieties of corn plants that exhibit the following…
A: Mendelian Genetics and Independent AssortmentMendel's laws of segregation and independent assortment…
Q: Place an asterisks (*) next to the 3' carbon atoms in the polynucleotide shown. -0 CH₂ H OH DH…
A: This is an example of a Polynucleotide present in DNA. A nucleotide consists of a deoxyribose…
Q: At higher magnifications, the millimeter markings may be too far apart to appear together in the…
A: In this initial stage, our objective is to comprehend and assess the provided formula designed for…
Q: Descendants of Queen Victoria (1819-1901) of England is believed to have suffered from hemophilia B,…
A: The objective of the question is to determine the probability of having a normal child if a son…
Q: Please create a very detailed experiment regarding the following ultimate hypotheiss about meerkats…
A: Meerkats are small carnivores that are part of the mongoose family. They are known for their complex…
Q: If the following 2 people had children, give one trait that they might have: ST.
A: When a child is born, some traits are inherited from the parents and some traits are acquired in his…
Q: Where would one find the axillary buds in the plant stem? -between the leaf petiole and the leaf…
A: The objective of the question is to identify the location of axillary buds in the plant stem.
Q: Determine the possibilities to carry out a complementation test on two dominant mutations.
A: A complementation test can be used to determine the mutation in two different strains or genes. If a…
Q: Differentiate between surface immobilisation and microencapsulation of enzymes and discuss the…
A: Surface Immobilization - It involves the immobilizing the enzymes by attaching enzymes to a solid…
Q: Determine chromosome theory of heredity.
A: In 1902, Walter Sutton and Theodor Boveri independently proposed the chromosome theory of…
Q: Explain the reason as to why Hershey and Chase did not take carbon as radioisotope but 32р as the…
A: Hershey and Chase conducted their experiment on E. coli bacteria to determine the genetic material.…
Q: What features are associated with the leaf epidermis? A) Guard cells.B) Trichomes.C) Cuticular…
A: The leaf epidermis is the outermost layer of the leaf, often coated with a waxy, waterproof cuticle…
Q: Consider figure 22.4. The following statements are true. Choose all applicable options. a)…
A: The figure depicts the evolution of fish fins into limbs suitable for walking on land over millions…
Q: Sickle-cell hemoglobin has not been bred out of existence because individuals with on sickle-cell…
A: Evolutionary Benefit the sickle- cell traits are more resilient to the severe effect of malaria,…
Q: Sexual spore production by Penicillium is by a zygosporangium True False
A: The question is asking whether the sexual spore production in Penicillium, a type of fungus, is…
Q: What traits do bryophytes and tracheophytes have in common? Check all that you think apply.A) they…
A: The question is asking to identify the common traits between bryophytes and tracheophytes.…
Q: What is true of eudicots but not monocots? -Eudicots have vascular bundles scattered in their…
A: The question is asking us to identify a characteristic that is true for eudicots but not for…
Q: Consider figure 22.5b. The following statements are true. Choose all applicable options. a) Hair…
A: Humans and chimpanzees followed divergent evolutions in which both have a common ancestry but due…
Q: Fill in the Blank • Clade Clade Chromalveolata Clade Archaeplastida . • Clade Excavata Clade…
A: A clade in ecological phylogenetics is a group of creatures on a tree of phylogeny which are…
Q: For questions 4-5, consider a pea plant trihybrid for tall stems, and yellow, round seeds. ✓4. How…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: the material properties of TPU and why it is ideal to be used as a medical scaffold around the…
A: 1. Biocompatibility: - TPU exhibits excellent biocompatibility, meaning it is well-tolerated by…
Q: Consider the trait in Figure 22.5a. Which statement about this trait is correct? Please choose the…
A: Evolution is the developmental process in which useful variations accumulate in a population and are…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 3 steps
- Bong Question #1: The diagram below depicts the regulatory regions for two (made-up) genes, which contain cis-regulatory sequences X, Y, and Z and bind to transcriptional regulatory proteins: zelo led diogot bolgate SMARTY – a transcriptional ACTIVATOR protein, which is present in all neuronal cells and binds to cis-regulatory sequence, X1oq & vino 19vewod.152 moldong sai mut tum BRAWNY-a transcriptional ACTIVATOR protein, which is present in all muscle cells and binds to cis-resgulatory sequence, Yolgulum di ko malo na SNARKY - a transcriptional REPRESSOR protein, which is present in peripheral neurons only and binds to cis-regulatory sequence Z 100 bio se i da se lotimo broup gniwollt od 19 bolgate ons zegg or we de base do no me to stir noitesup od went of sistemos seu anoitesup 15wens horle 10oldog woy ni gnius stoted 1910 ni tatayot ovizasovo got no rade od lliw anioq azia oo ingene Aroom or b X y Jeol VELY gan 100 Tonnodige ΤΑΤΑ, 229nibrow dong H .aodto diw atse meldong mov.no o…You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC AAGCTCGAGAGCAСCAGCTСТАТGCGСТАСТАТААТGAССАКТАТАСССТАCGTGATAG 5" 3' RNA promoter polymerase 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you know? 4b. What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3' --- 4c. What are the first 5 amino acids encoded by this gene? )Note - there is a codon table available at the beginning of this exam. N' C' 4d. Will translation stop at the UAA which begins at position 41? Explain your logic 4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new…You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 ТТCGAGCTCTСGTCGTCGAGATACGCGATGATATTАСТGGТААТАТСGGGАTGCАСТАТС 3' 5' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATAÇECCTACGTGATAG ΤΑTC promoter RNA polymerase Practice Question 4 C) What are the first 5 amino acids encoded by this gene? N' C' ribosome
- From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to control its expression THERE ARE MULTIPLE ANSWER TO THE QUESTION Group of answer choices A RNA polymerase II B 3' UTR C mediator protein D 5' UTR E activators F coding sequence G specific transcription factors H general transcription factorsA single mutation in one of the transcription factors inProblem 33 results in a drastic reduction in YFG transcription. Diagram what this mutant interaction mightlook likeThe following diagram depicts the elements at the: 999 2 cacc tata as tatafan A ACG TTC ATT BRE TATA box Inr DPE (TBP) TFIIB TFIID O Promoter Enhancer transcribed gene Silencer
- You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 AGATACGCGATGATATTACTGCTA AAGCTCGAGAGCAGCAGCTCТАTGCGCTACТАТААТGACCАТТАТАССССТАCGTGATAG 3' TТCGAGCTCTСGTCGTCGAGA ПААТАТСGGGATGCАСТАТ С 5' RNA promoter polymerase Practice Question 4 G) You also study the expression of different mutants for this gene. Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? For mutant C answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any)…You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAA! AAGCTCGAGAGCAGCAGCTСТАTGCGCTAСТАТААТGACСАТТАТАССССТАСGTGATAG 3' СTGGIAATATOGGGATGCACTАТС 5' RNA promoter polymerase Practice Question 4 F) You also study the expression of different mutants for this gene. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above). For mutant B answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3' promoter m in…Refer to the following illustration to answer the question. O protein A is not made because it is normally required for its own transcription TRANSIENT SIGNAL TURNS ON EXPRESSION OF PROTEIN A What is protein A? O a maintenance methyltransferase O a histone PAY O a cell type-specific gene regulator a HAT (histone acetyltransferase) any of the above PAD the effect of the transient signal is remembered in all of the cell's descendants
- The Assembly of Class III Transcription Initiation Complexes consists of TATA-binding protein (TBP) TBP-associated factor (TAF) Both NoneWhich of the following general transcription factors aids polymerase binding in the right direction on promoters? Group of answer choices TFIID TFIIB TFIIA TFIIFWhich of the following would be used to describe a gene that is transcriptionally controlled by activator ahd/or repressor proteins? Constitutive Regulated Environmental-independent. Permanently repressed. Permanently enhanced. Moving to another question will save this response. 144 Hz ms CURVED Optix MAG271C CAMING Firameless Desgn Gomine Os0 APP msi High Rofresh Rate Fast Respense Time Curved Gaming