Which of the following is 18:248,11?
Q: Ketohexoses commonly exist in living systems in either the straight chain or ring (furanose) forms.…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: calculate the [PNP] in μM for each of these samples.
A: Molarity is way of representing the concentration of a solution. Molarity is number of moles of…
Q: 2. The mechanism of HMG-CoA reducatse enzyme activity involves several stages. For the catalytic…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Determine whether each of the examples or phrases describes an essential amino acid, a nonessential…
A: INTRODUCTION: They are the building blocks of proteins and amino Group (NH2) and Carboxyl Group…
Q: In the experimental set up to show that "CO, is given out during respiration", name the substance…
A: Respiration is a metabolic process that all organisms go through. It is a biochemical process that…
Q: A student performed an invertase activity assay on samples from a purification. All reactions…
A: Beer Lamberts law relates absorbance with concentration of analyte. The Beer lamberts expression is…
Q: Suppose a student rinses their buret with water instead of sodium hydroxide, leaving water in the…
A: Introduction The titration is a chemical process by which the quantity of one substance of a sample…
Q: The last residue of the protein (tail) is Tryptophan, and the first residue (head) is labeled with…
A: Fluorescence Resonance Energy Transfer (FRET) or simply RET is a technique used to calculate the…
Q: Glycogenin is a homodimer of 37 kDa subunits. (Homodimer means identical subunits of type a that…
A: Glycogenin: It is a transferase that produces glycogen, which is a crucial type of glucose storage…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-CACGGGG-3'
A: Deoxyribonucleic acid (DNA) is a double stranded polynucleotide coiled around a central axis to form…
Q: Below is a Michaelis-Menten plot for a wild-type (WT) and mutant (V105A) enzyme isolated from the…
A: The best way to find out the Vmax and Km values are by plotting the Lineweaver Burk Plot (LB Plot).…
Q: You are interested in cloning a gene that codes for an enzyme that produces a blue pigment. You have…
A: Introduction pUC19 is plasmid vector. Plasmid is a cloning vehicle used in recombinant DNA…
Q: Write a description of the physical characteristics of the isolated starch and glycogen. Provide the…
A: Starch and Glycogen are Polysaccharides, made up of many units of monosacharides. Starch is reserve…
Q: 1- Catalyzes the production of FADH, in the Krebs cycle: a) isocitrate dehydrogenase b) aconitase c)…
A: The acetyl CoA molecules that are synthesized as the end product of carbohydrate, protein, and lipid…
Q: Question 5 An a-helix has the sequence: NH3-Ser-Glu-Gly-Asp-Trp-Gln-Leu-His-Val-Phe-Ala-Lys-Val-Glu-…
A: Alpha helix is a type of secondary structure of proteins. It is the rod-like structure formed when…
Q: true/false: Transamination reactions yield an a-keto acid and an amino acid.
A: The amino acids undergo reactions like transamination and deamination. As the name suggests the…
Q: 3. Predict the effect of each of the following amino acid substitutions on the KM and keat of the…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Which monosaccharide(s) seen below is(are) an epimer of the structure on the left? H- НО Н- H CHO О…
A: Two isomers that are correlated to one another by reflection are called optical isomers or…
Q: calculate the [PNP] in μM for each of these samples. For Table 2: Calculate the volumes of the 100…
A: 0.5mM =0.5 ×10-3 moles literi.e. 1 liter have 0.5 ×10-3 molesSo, 106 μL have 0.5 ×10-3 molesSo, 1…
Q: Select ALL statements that are true about the isoelectric point (pI) of a protein a.Protein carries…
A: The isoelectric point (pI) of a protein is the pH at which the protein is neutral or the overall…
Q: In 1958, Meselson and Stahl conducted an experiment to determine which of the three proposed methods…
A: Three important experiments contributed to our current understanding of DNA structure and function:…
Q: A gerbil is fed a normal diet including 14C-lysine. After a period of time on this diet biopsies are…
A: Gerbils are mammals , so only mammalian metabolism can be used here. In the figure below showing the…
Q: Are there anymore features that limit the protein configurations?
A: A protein's biological function depends on its three-dimensional structure. The 3D structure is…
Q: A buildup in the levels of acety-CoA would result in the inhibition of what reaction in…
A: Fatty acid β-oxidation is the process of breaking down a long-chain acyl-CoA molecule to acetyl-CoA.…
Q: In order to break the carbon-carbon bond of Acetyl-CoA in a way that does not harm the cell, citrate…
A: Glycolysis is the metabolic pathway by which 6-carbon glucose is converted into 3-carbon pyruvate in…
Q: After 7 rounds of b-oxidation completely converts fluorooleate into acetyl-CoA, draw the molecule…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: Which of the following is NOT true of DNA Methylation. A. DNA methylation is typically…
A: DNA methylation is an epigenetic mechanism by which methyl groups are transferred to the DNA onto C5…
Q: Metabolic Integration Q9.1: Glucose-6-phosphate is a key metabolic intermediate in four major…
A: Glucose-6-phosphate is the key metabolic intermediate where it is branched to four major metabolic…
Q: Please help me calculate BSA and Net Abs (explaination and details pls)
A: Bovine Serum Albumin (BSA) is the most commonly used protein in research. It is obtained from the…
Q: 3. Question from Lehninger...describe the common structural features and the differences for each of…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. They are…
Q: The Gs-alpha subunit of trimeric G proteins can function to regulate ion channels. inhibit…
A: Introduction: G-protein is a heterodimeric containing three different subunits named alpha, beta,…
Q: What would be the effect of a visualizing agent on the retention factor. Rf? A.Higher Rf B.Lower RF…
A: Visualising agent: The chemical agents that can be used to detect the number and location of the…
Q: 1. Draw the structure of the polyribonucleotide UAGCCUG. 2. Draw the structure of the…
A: Nucleotides are phosphoric acid esters of nucleosides (pentose sugar containing a nitrogenous base).…
Q: The structure of purine is shown. 2 N-1 N-3 N-7 N-9 6 5 N 4 3 7 N -N9 ZI 8 Which atoms of the purine…
A: Purines: The two groups of nitrogenous bases, which also include the two groups of nucleotide…
Q: The structure given below represents what molecule?
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: Explain how gluconeogenesis ang glucogenolysis are regulated to maintain blood glucose levels during…
A: Gluconeogenesis is the process of transformation of non-carbohydrate substrates ( lactate, amino…
Q: 1 ).Which of the following accurately describes substrate specificity for serine proteases? A.The…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group attached to…
Q: a) This molecule is produced when what amino acid is transaminated? b) What are the one- and…
A: Introduction Amino acids are the building blocks of protein. Two amino acids are joined by peptide…
Q: I'm a bit confused for part c answer to this question, would it be possible to restate the answer…
A: PFK catalyzes the phosphoryaltion of fructose 6 phosphate to fructose 2,6 bisphosphate. PFK is an…
Q: Using the following key terms, discuss the regulation of carbohydrate metabolism. Insulin,…
A: Introduction Glycolysis is a process by which glucose converts into pyruvate and ATP is produced.…
Q: NH4+ is transported indirectly in the body. Why can’t free NH4+ be transported in the blood? How is…
A: NH4+ is the waste product formed from the amino acids on their catabolism. It must be transported…
Q: Upon doing the experiment in Protein Denaturation, what could happen in the precipitation of heat…
A: Protein solubility is determined by the proportion & distribution of polar hydrophilic and…
Q: You run an SDS-PAGE gel on some purified protein samples against a protein ladder as marked. kDa 225…
A: SDS PAGE is an electrophoretic technique, which is used to separate proteins based on their size.…
Q: 10) Determine bending rigidity of double stranded DNA molecule with persistence length of 45 nm (80%…
A: Deoxyribonucleic acid (DNA) is a double stranded polynucleotide coiled around a central axis to form…
Q: d. What type of inhibition is exhibited against NAD* as a cofactor? Describe what is going on in…
A: There are three types of inhibitors-competitive, non-competitive and uncompetitive. In competitive…
Q: true/false: Pepsin cleavage of the peptide Ala-His-Gly-Trp-Val-Ile-Arg-Gly would yield the…
A: Pepsin is a proteolytic Enzyme that cleaves the peptide bonds with specificity. This can be used in…
Q: The pancreas is an organ of mixed secretion. Endocrinely, beta-cells produce the hormone insulin,…
A: Pancreas has 3 types of cells: α cells secrete glucagon β cells secrete insulin δ cells secrete…
Q: The metabolic function of the pentose phosphate pathway is: act as a source of ADP biosynthesis O…
A: The breakdown of glucose, in glycolysis provides the starting molecule required for the pentose…
Q: 1. What mRNA sequence does the following DNA template sequence produce? DNA…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: 4. Name this lipid. H₂C(CH₂) CH 0 CH₂-0-C-(CH₂)12CH3 0 CH(CH₂-C-0-CH COO™ CH₂-O-P-0-CH₂-CH 0 NH
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q7
Step by step
Solved in 2 steps with 1 images
- C UUU UUC Phe UUA UCU) UCC UCA UAU UAC Tyr UGU UGC Cys Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG FLeu UCG CUU CUC CCU] СС CAU1 CAC САC His САА Gln CGU CGC Arg Leu Pro CUA CUG ССА CGA CUG J CCGJ Which of the following tRNA anticodons could theoretically base pair effectively with the codons 5'-AAU-3' and 5'-AAC-3' through third-base CAG, CGG AGU AAUASN AGC AUU AUC File A AUA ACU АСС АСА AAC FAsn AAA Ser C Thr AGA Arg A AUG Met ACG AAG Lys AGG GCU] GCC GCA GCG GGU GGC Gly GGA GAU1 GUU GUC GUA GUG Asp GACJ GAA C Val Ala A GAG Glu GGG wobble? 5'-GGG-3' OI. 5'-AUG-3' II. 5'-GUU-3' I. 5'-CAT-3' IV. 5'-AAA-3 V. Third letter UCAG UUAG A, First letterWhich of the following statements is incorrect?Is this statement true or false? exlain why
- OHHH HHHH H H H HH -с-с-с-с-с-с-с-с-с-с-с-с-с HH H H H H H H H HHH H H H H H H H HHH H-C-O C-C- OH H H H H H H H H-C-0 C-C-C-C CH, H H H,CN-C-c-o-P-0-c-H CH, H H H H H H H H H c-c-c-o What do you call the structure enclosed in the rectangle? What type of chemical bond is represented by the structure with an arrow?. What structure does the bond identified in # 2 create in relation to the entire molecule shown? True or False: This molecule is non-amphipathic. (True or False) I-0-I세 메 B D C F E ㅁㅁㅁ -40-404 | 1602 40000 H ㅁㅁㅁ ㅅㅁㅅㅁㅅㅁJennifer plans to go to graduate school so she can specialize in _______________. This specialty is concerned with the study of all aspects of disease.
- 1 10 20 30 40 50 60 70 -I---- 5' АTCGGTCТCGGCTACTACАТАAАСGCGCGCATATATCGAТАТСТАGСТАGСТАТCGGTCTAGGCTACTАC 3' TAGCCAGAGCCGATGATGTATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG I--------I--- --I--- --I------ --I--- -I---------I Promoter 80 90 100 110 120 130 140 -I---- 5' CAGGTATсGGTCTGATCTAССТAGCTTCTтсттстстстстсссссGCGGGGGCTGTACTATСATGCGTCG 3' GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC -I- -I------- -I--- -I---------I RBS 150 160 170 180 190 200 210 -----I--- ---I-- ------I- ---I---------I---- -I---------I 5' тстCGGCTАСТАCGTAAACGCGCGCATATAтCGATATCTAGCТAGСТАТСGGTстCGGCTACTAсGTAAA 3' AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT 220 230 240 250 --I----- ---I-- ------I--- -I 5' CCCTATTAGCATGGGTCATATTTGTGTCTGCTTGTTGGGT 3' GGGATAATCGTACCCAGTAGAAACACAGACGAAGAACCCA a. What are the nucleotides of the MRNA from gene Z? b. What are the amino acids encoded by gene Z? ( Vate VHindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)What will happen to K-V-F-W-P-L-I-Y in the following treatments: a. Chemotrypsin treatment b. Trypsin treatment C. Pepsin treatment d. Thermolysin treatment