Which of the following is a transition mutation? OC--> G OC --> T OC --> A
Q: importance of nutrition
A: Nutrition is the biochemical process by which an organism eats a healthy and balanced diet through…
Q: An Autosomal Dominant trait is only evident in the homozygous state. True False
A: A Dominant inheritance occurs when an abnormal gene from one parent is capable of causing disease.
Q: How do you calculate RNA concentration?
A: DNA and RNA are made up of long chains of nucleotides. Sugar molecule, ribose in RNA, and…
Q: Consider the analogy of the jiggling box containing coins that was described on page 85. The…
A: When we face a situation where rate of forward reaction is euqal to the rate of backward reaction…
Q: 8. Which of these is not an example for stereo specificity? a) L-lactate dehydrogenase will act only…
A: Many enzymes can discriminate between enantiomeric substrates and such enzymes exhibit…
Q: (a) Draw the condensed structural formula, and give the name and abbreviation for the dipeptide…
A: Dipeptide is the structure formed by two aminoacids with a single Peptide bond. Anomeric carbon is…
Q: topic: sds-page gel If APS is not available, what other chemicals can be used alternatively to…
A: APS stands for Ammonium Persulfate. It is an oxidizing agent that is used along with TEMED in order…
Q: calculate the net charge of your peptide at I) pH 2.0; ii) pH 6.0 iii) pH 7.0; iv) pH 11.5. show…
A: Amino acids contain ionizable groups, the ionic form of the amino acids depends on the pH. The…
Q: 2. Complete and identify the enzymes involved in the following pathways OydroyacetoreP tructose…
A: The glycolytic pathway helps to metabolize glucose molecules obtained through the diet, glycogen…
Q: What does protein function in the human body?
A: Proteins are made up of amino acids or we can say that amino acids are the building block of…
Q: Сно сно CH,OH Fo но H- HO- H- Phosphorogluco- isomerase Phosphofructo- kinase Нехоkinase но H- но…
A: The given pathway represents the glycolytic pathway, through which the glucose molecules are…
Q: Some protein kinases are inactive unless they are phosphorylated on key serine or threonine…
A: The activity of many proteins are modulated by post-translational modification of the proteins.
Q: Which among the following statements is correct? Negatively-charged proteins are eluted out first…
A: Affinity chromatography is an analytical method for separating biomolecules in a mixture, based on…
Q: Indicate what step each of the events in the glycolysis pathway the following takes place: a. First…
A: Glycolysis is a metabolic pathway which converts glucose into pyruvate.
Q: 1. List several methods (other than Bleeding Time -Ivy method, Capillary Tube Method, Lee and White…
A: Introduction: Bleeding time: It is the time interval between the skin puncture and spontaneous,…
Q: COO co0 C=0 C=0 + CH2 ČH3 COO The name of enzyme that catalyzes above reaction is Select ] and the…
A: Here, a reaction is given in the question and we have to identify the enzyme which catalyzes this…
Q: Genetically modified cotton plants produce the toxin encoded from the gene originated from the…
A: Any organism whose genetic material has been altered using genetic engineering techniques is…
Q: Indicate at what step number in the glycolysis pathway the following event occur and why? a.…
A: Glycolysis is the metabolic pathway that converts glucose into pyruvic acid.
Q: NADH produced in glycolysis is transported to the mitochondria where the electron is transferred to…
A: Glycolysis is also known as the Embden Meyerhof pathway and it is highly conserved from humans…
Q: With the aid of diagrams describe the signalling pathway involving inositol 1,4,5 trisphosphate from…
A: Membrane phospholipids can act as precursors from which second messengers can be produced during…
Q: Different types of mutations and how to use the genetic code table.
A: Mutations are described as the changes that occurs in the sequence of DNA. Mutations can occur from…
Q: 2. Biosynthesis of thyroid hormones. Proteins: A. Thyroglobulin with DIT. B. Thyroglobulin with T C.…
A: As shown in the given figure, thyroid hormone synthesis occurs in following steps: iodide (I-)…
Q: As listed in the LIPID MAPS Structure database, a synonym for 18:2w-3 using the (n-x) nomenclature…
A: LIPID MAPS computationally-generated database of "bulk" lipids.
Q: What are massive, insoluble, high molecular weight compounds that have brown color? Not…
A: The brown pigment observed in different foods such as cookies, breads etc is the result of a…
Q: 8. Which of the following is commonly known as the Complex II of the electron transport system of…
A: Electron transport chain is a series of protein and organic molecules located in the inner membrane…
Q: For carbohydrates to be converted to energy, it undergoes the process of metabolism, where in the…
A: Carbohydrates are major energy source of human beings. It is most important component of our diet .…
Q: A glycogen polymer and an amylopectin polymer, each containing 100 monosaccharide subunits, are…
A: Amylopectin and glucogen are examples of branched polysaccharides.
Q: Step by Step process of Embden-Meyerhof pathway of RBC metabolism Pls Explain as simple as…
A:
Q: explain why the protein binding of the drug is not correlated with the distribution or elimination…
A: Many drugs form drug macromolecule complexes by interacting with plasma, tissue proteins, or other…
Q: Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation?…
A: Steps in Prokaryotic Translation Initiation: GTP bond Initiation factors (IF1-3) binds to 30S…
Q: Pyruvate is produced in glycolysis and used by Kreb's Cycle in the mitochondrial matrix. How does…
A: Glycolysis is the process by which glucose is converted to pyruvate along with production of…
Q: Which peptide will yield the following qualitative resul Millon's Test (+) Fohl's Test (+) Sakaguchi…
A: Introduction: Amino acids are the building block of proteins and are linked to a peptide bond. Each…
Q: topic: gel electrophoresis What is the purpose of the running buffer?
A: The gel electrophoresis is a biochemical technique, which helps to separate the proteins and DNA,…
Q: RBC metabolism pls explain as simple
A: RBCs are metabolically active , complex cells that used up glucose in order to generate ATP or…
Q: When using blunt-end primers, how would you determine the correct plasmid construct from the…
A: Ligation is the joining or ligation of two nucleic acid fragments through the action of a ligase…
Q: Is it somehow possible to generate carbohydrate from non-carbohydrate? If yes, how and if no, why?
A: Carbohydrates are organic molecules, which act as the primary source of energy. Glucose is the…
Q: Draw and label a structure of: A diglyceride of oleic acid
A: A diglyceride is composed of a glycerol molecule attached to two fatty acids through ester bonds.…
Q: 5. What molecules are missing from boxes in the gluconeogenesis reaction shown below 203PO- OPO,2…
A: H2O
Q: Question 2 You are using molecular modelling software to examine the X-ray crystal structure of the…
A: Beta-Adrenoreceptor: They are GPCR and contain seven transmembrane helices. It is widely distributed…
Q: a) Which catalytic mechanism occurs in step 2? b) Why must phosphate first bind to succinyl-CoA…
A: Glycolysis, TCA cycle, and ETC all are interconnected processes. Respiration is an oxidative…
Q: 1. The following lipids are important structural components of the cell membrane of fish. Draw the…
A: The membrane phospholipids have a glycerol backbone.
Q: Protein denaturation is the disruption of a protein's secondary to quaternary structures. Protein…
A: Denaturation is a process in which proteins or nucleic acids lose their native quaternary, tertiary,…
Q: In your own words, what do you think is/are the reason/s why most of the clinical features of these…
A: Krebs cycle disorders are a set of rare human diseases with a remarkable level of complexity when…
Q: Using punnet square, determine the chances of an autosomal recessive trait produced from the cross…
A: The Punnett square is used for the determination of genotype. Punnett square is a square diagram in…
Q: How does compromised pyruvate kinase activity lead to anemia?
A: Pyruvate kinase is a catalytic enzyme that catalyzes the final step of glycolysis, which is crucial…
Q: A 2x10-6 dilution of your bacterial culture yielded 10 colonies. What was the cell density (in…
A: The purpose of dilution of the bacterial culture before plating is to ensure that the cells are are…
Q: Why people with PK deficiency may tolerate a lower hemoglobin level than people with other types of…
A: Pyruvate kinase deficiency (PKD) is the most prevalent congenital glycolysis enzymatic abnormality…
Q: 1. A student, halfan hour after the dinner, containing about 150 g of carbohydrates, 20 g of fat,…
A: Hi! Thank you for the question. We are authorized to answer one question at a time, since you have…
Q: Determine the vitamin content of the following fruits and vegetables using…
A: Introduction: Vitamins are organic compounds present in food that are needed in minimal amounts for…
Q: 5. Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but…
A: The RBCs are the cells which carry oxygen to various tissues. The RBCs yield energy from the…
Step by step
Solved in 3 steps
- Describe the mutation that occurs in the following examples (be specific, if possible): BOAT to BAT SOAP to SOUP PAY to PLAY GCTCT to GCACT TGCCC to TACCC CATGC to GATGC TATATA to TACATAA wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertionA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Gly
- A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. MMutant 4: Met-Ser-Pro-Glu-GlA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 2: Met-Ser-ProA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly
- A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-GlyWhich of the following is a transversion mutation Select 4 correct answer(s) A --> T C --> T C --> G A --> G A --> C G --> T2. A reversion is a mutation that returns a mutant codon back to a codon that gives a wild-type phenotype. At the DNA level, this type of mutation can be an exact reversion or an equivalent reversion. GAG First GTG Exact GAG (glutamic acid) mutation (valine) reversion (glutamic acid) GAG - GTG First Equivalent (valine) reversion GAA (glutamic acid) mutation (glutamic acid) GAG First GTG Equivalent - GAT (glutamic acid) mutation (valine) reversion (aspartic acid) An equivalent reversion produces a protein that is equivalent to the wild type in structure and function. This can occur in two ways. In some cases, the reversion produces the wild-type amino acid (in this case, glutamic acid), but it uses a different codon than the wild-type gene. Alternatively. an equivalent reversion may substitute an amino acid structurally similar to the wild-type amino acid. In our example, an equivalent reversion has changed valine to an aspartic acid. Because aspartic and glutamic acids are structurally…
- Which of the following sequences is most likely to form a beta-turn? Explain why? Sequence A: Ser-Pro-Asn-Val Sequence B: Gly-Ser-Asn-Pro Sequence C: Ser-Asn-Gly-ValThe following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairingThe genetic alteration responsible for sickle-cell anemia in humans involves: a transition mutation from A to G, substituting glutamic acid for valine in a-globin a transversion mutation from T to A, substituting valine for glutamic acid in b-globin a transition mutation from T to C, substituting valine for glutamic acid in b-globin a transversion mutation from G to C, substituting glutamic acid for valine in a-globin a frameshift mutation of one ATC codon, removing glutamic acid from b-globin