Which of the following reactions is the most exergonic? a Conversion of PEP to Pyruvate b Conversion of Glucose-6-phosphate to Glucose c All of the reactions are equally exergonic. d Hydrolysis of ATP
Q: Acetyl CoA + 2H* + 2e = pyruvate + COASH Ubiquinone + 2H* + 2e = Ubiquinol E* = -0.48 V E" = +0.04 V…
A: If the reaction has a positive value of standard cell potential/standard reduction potential or a…
Q: 5. Salivary a-amylase cleaving a(1 example for which type of specificity? a) Group specificity b)…
A: Group specificity : Enzyme will catalyze the reaction on a function group of different molecules…
Q: Transport of lipids in blood involve lipoproteins which includes the LDL and HDL commonly referred…
A: Lipoproteins carry fats in the bloodstream. Lipoproteins are made up of an inner core of hydrophobic…
Q: importance of nutrition
A: Nutrition is the biochemical process by which an organism eats a healthy and balanced diet through…
Q: 5. Which of the following enzymes catalyze the ADP-ribosylation of key cellular enzymes or proteins?…
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…
Q: The Human genome project used the following methods Shotgun Sanger Both None
A: The Human Genome Project : It was an international effort to find the DNA sequence of the complete…
Q: Solve the following problems using the basic assumptions: 1 NADH --> 2.5 ATP; 1 FADH2 --> 1.5 ATP…
A: When there is no carbohydrates available in the body, the fatty acids undergo β-oxidation to yield…
Q: The most regulated enzyme in glycolysis is a Hexokinase b G3P Dehydrogenase c Pyruvate…
A: Glycolysis is a metabolic pathway during which glucose molecule splits into pyruvate molecules with…
Q: How does ground state destabilization, transition state stabilization, and proximity lead to…
A: Enzymes are protein molecules that speed up the biochemical reactions by decreasing the activation…
Q: 1. Search for a journal article about a certain drug that targets (whether stimulate or block) a…
A: a) Cystic Fibrosis is a genetic disorder caused by mutations in the gene encoding for CFTR i.e…
Q: What is the ATPase
A: Adenosine triphosphate (ATP)ases are a class of enzymes that catalyse the hydrolysis of a phosphate…
Q: Which of the following genes have internal promoter elements? 5S FRNA MRNA snRNA None of the above
A: Promoter : the sequence that are important in the initiation of transcription of a transcription…
Q: Which of the following statements are TRUE? Multiple answers:Multiple answers are accepted for…
A: The TCA cycle or tricarboxylic acid cycle is the second stage of cellular respiration. This is a…
Q: Which of the following statements are TRUE? Multiple answers are accepted for this question a .Two…
A: Two answers are correct
Q: What are other staining methods that can be used for PAGE?
A: Introduction: PAGE electrophoresis is a subtype of gel electrophoresis whereby normal gel is…
Q: According to the Arrenhius theory, an acid is: a. a substance that forms hydroxide ions b. a…
A: Arrhenius theory gives us the concept of acid and base. This theory is given based on the…
Q: The DNA and associated proteins of a eukaryotic chromosome are called Chromatin Chromatosome…
A: Eukaryotic chromosomes are made up of DNA that is tightly coiled around histone protein clusters.…
Q: Name of complex Electron donor No. of H+ ions pumped (NADH/FADH2) 1. 5. 7. 2. 6. 8. 3. 9. 4. 10.
A: The electron transport chain occurs in the mitochondria. There are four electron transport chain…
Q: 8. Which of the following takes place due to phosphorylation of isocitrate dehydrogenase? a)…
A: Isocitrate dehydrogenase is effectively recognized as a key factor in the Krebs cycle, where it…
Q: What does blood typing detect? presence of surface feature molecules in the blood anti-sera…
A: Using the method blood typing, the universal ABO blood group system has been established.
Q: Question Which of the following activities of DNA pol lis MOST important in proofreading A 5' to 3'…
A: The DNA replication in the newly added base are read by DNA pol I enzyme to check weather the added…
Q: What is the process in which antibodies attach to antigens, causing the formation of masses of…
A: Because the Y-shaped antibody arms randomly attach to many surfaces of non-self red blood cells,…
Q: If 100% of the free energy from the metabolism of glucose is used for the conversion of ADP to ATP,…
A: The equation for the oxidation of glucose is:
Q: Polyadenylation signal sequence is present in Termination region 3'UTR O Poly(A) tail All of the…
A: In eukaryotes the process of polyadenylation involves the addition of a poly(A) tail to a mRNA…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: Match the blood glucose source with its fate/outcome.…
A: Blood sugar which is also known as glucose is described as one of the crucial as well as major sugar…
Q: TRUE or FALSE: Lipids may originate through carbocation-based condensation of thioesters or by…
A: Introduction: Lipids are a heterogeneous group of biomolecules that includes fats, oils, waxes,…
Q: Sample pH vs Initial Velocity (AA450/60 seconds) a bo16 0.0014 al0012 0.0008 0.0006 0.0004 0.0002 pH…
A: Enzymes are biological catalysts that are capable of catalysing a reaction by binding to Substrate.…
Q: From an extract of human cell growing in tissue culture, A fibrous substance was obtained. How would…
A: Introduction: The primary structure of both DNA and RNA are similar. Each consists of a…
Q: Complete the table below by supplying AT LEAST ONE example of a monomer with its polymer for each…
A: Lipids are hydrophobic or hydrophilic bio macromolecules which can be of several types like fatty…
Q: Restriction digestion of DNA fragments is not sequence specific. True False
A: Within a few years after discovering EcoB, EcoK, and HindII, scientists were already experimenting…
Q: explain the relationship between glycogen metabolism, the pentose phosphate shunt, dyslipidemia,…
A: Glycogen metabolism is the glycogenolysis or breakdown of glycogen during fasting and muscle…
Q: Name the complexes of the ETC, electron donor, and determine the number of H+ ions that are pumped…
A: Electron transport chain and chemiosmosis are part of oxidative phosphorylation. Oxidative…
Q: citric acid cycle
A: Citric acid cycle is one of the pathway of the carbohydrate metabolism which is also known as the…
Q: A glycogen polymer and an amylopectin polymer, each containing 100 monosaccharide subunits, are…
A: Amylopectin and glucogen are examples of branched polysaccharides.
Q: Describe the properties of water that are critical to maintaining life Include a discussion of…
A: Water most important element on earth without that life on earth can not be possible , without water…
Q: Which polymerase transcribes genes with internal control regions (ICR)? O RNA Pol I RNA Pol III RNA…
A: The eukaryotic cells have three distinct RNA polymerases that transcribe different sets of genes.
Q: Golden rice is genetically modified to express the following
A: Golden rice is one of the genetically modified variety of rice.
Q: 3. Draw the chemical structure of cholesterol and state its functions 4. Explain in detail the…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Which of the following is the correct order of mechanism of how sugar is perceived? Signal…
A: Glucose is a monosaccharide and it is a simple sugar that is the most important source of…
Q: Human hemoglobin as a tetrameric protein of about 64.5KDa consists of 2 beta chains. Calculate the…
A: Hemoglobin : It is a iron containing metalloprotein found in red blood cells . Hemoglobin in the…
Q: 1.Explain how dietary lipids are absorbed by the human body.
A:
Q: The Lineweaver-Burke plots of a reaction without inhibitor and one with non-competitive inhibitor…
A: Enzymes are catalysts that enhance the rate of biochemical reactions.
Q: Since pepsin is a gastric enzyme, does it have an acidic or alkaline optimum pH? • What happens to…
A: The gastric juice comprises of water, mucus, hydrochloric acid, pepsin, and intrinsic factor and…
Q: Question 21 Transcription of a typical gene encoding a polypeptide in eukaryotes involves all of the…
A: Transcription is the process that occurs in nucleus of a cell that involves the Synthesis of mRNA…
Q: 1. Shown below is a metabolic pathway: Es E4, E F > E1 E3 A - B C - D E2 E6 R E7 Es Suppose we have…
A: Note : Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: amino acids as precursors
A: Amino acids acts a precursor pf many other nitrogen containing compounds which are Porphyrines,…
Q: Where is the labeled carbomn found when the folliowing molecules are added to a cell carrying out…
A: Palmitate synthase is the enzyme complex that synthesizes the 16 carbon long saturated fatty acid…
Q: Describe the β-oxidation of the fatty acid palmitate
A: Beta oxidation in biochemistry and metabolism is a catabolic process through which fatty acids…
Q: Consider the analogy of the jiggling box containing coins that was described on page 85. The…
A: When we face a situation where rate of forward reaction is euqal to the rate of backward reaction…
Which of the following reactions is the most exergonic?
| a |
Conversion of PEP to Pyruvate |
|
| b |
Conversion of Glucose-6-phosphate to Glucose |
|
| c |
All of the reactions are equally exergonic. |
|
| d |
Hydrolysis of ATP |
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which of the following is NOT produced during the oxidative phase of the pentose phosphate shunt? a Ribulose-5-Phosphate b Glyceraldehyde-3-phosphate c CO2 d NADPHIn the first stage of glycolysis, the hydroxyl group on C6 of glucose is phosphorylated to form glucose-6-phosphate (G6P). In this reaction, which of the following statements is true? a. O b. d. e. Glucose kinase is used to catalyze the reaction. Hexokinase is used to catalyze the reaction. A molecule of NADH is synthesized. One ATP is synthesized. Fructose kinase is used to catalyze the reaction.When NAD* accepts electrons during a glycolysis reaction, this is an example of a reaction. O phosphorylation O redox O dehydration O protonation
- How much fat (in grams) would the body have to burn to produce the daily minimum requirement of 40 kg ATP from ADP and phosphate? Assume that: 1. The fat is metabolized completely to water and carbon dioxide. 2. The energy that is released can be used entirely for ATP production. 3. Complete oxidation of 1 g of fat to water and CO2 releases 9 kcal or 37 kJ. 4. The Delta G for ATP hydrolysis is -30.5 kJ/mol. You will have to look up one more value online to answer this question, but you do not need to know anything about lipid metabolism. A) approx. 16 to 17 g of fat B) approx. 65 to 66 g of fat C) approx 22 to 23 kg of fat D) approx. 267 to 268 g of fat E) approx. 5 to 6 kg of fatThe condensation reaction catalyzed by ß-ketoacyl-ACP synthase synthesizes a four-carbon unit by combining a two-carbon unit and a three-carbon unit, with the release of CO₂. What is the thermodynamic advantage of this process over one that simply combines two two-carbon units? The reaction is reversible and does not require the input of ATP. The exergonic release of CO₂ drives the irreversible reaction in the direction of fatty acid synthesis. The release of CO₂ is endergonic and results in the production of ATP. The reaction is endergonic and requires the input of ATP.Steps in oxidative phosphorylation involves all of the following except 11. a. The phosphorylation energy is supplied by ATP metabolism b. Electron transfer chain moves electron from NADH and FADH2 to O2 c. Phosphorylation of ADP to ATP catalyzed by ATP synthase d. Electron do not flow to oxygen unless ATP is needed 12. List factors that can activate glucokinase for glucose metabolism in the liver 13. What are the functions of macromolecules with examples? Write the general balanced equation that shows the catabolism of glucose (GLYCOSLYSIS) to ATPS, carbon dioxide, and water. Include in the equation the formation of ATP from ADP and phosphate and oxygen utilization. 14. 15. What is post-translational processing of proteins and list 3 things that can happen to the proteins synthesized at this stage:
- The following reaction takes place during the synthesis of glycogen: Glucose 1-phosphate + UTP + H20 UDP-Glucose + 2Pi This reaction may be best described as a: a. exergonic, catabolic reaction O b. exergonic, coupled reaction C. oxidation-reduction reaction d. endergonic, substrate-level phosphorylation reaction e. exergonic, substrate-level phosphorylation reactionIn glycolysis, the glucose which has 6 carbonmolecule is eventually break down into 2 molecules of 3 carbon compound as the pyruvate. Regardless all the enzyme involved, describe the key points that change the 6 carbon compound into two molecule of 3 carbon compound.The reaction pictured is an oxidation-reduction reaction in the citric acid cycle in which the energy-carrier molecule NADH is generated. Identify which molecule in the reaction will be oxidized and which molecule will be reduced. Place a single answer choice in each box. COO- HO-C-H H-C-H COO- Malate NAD+ NADH + H+ Oxidized malate oxaloacetate COO- H-C-H ī COO- Oxaloacetate Reduced NADH NAD+
- Which of the following statements is true for the shown reaction? The reaction requires vitamin B1 A decrease in the ratio of NADH/NAD+ inhibits the reaction The only fate of the product Y is to be converted to succinyl-CoA All of the above None of the aboveDifferent enzymes that catalyse the same reaction are called O A. isoenzymes O B. holoenzymes O C. cofactors O D. coenzymes O E. agonists Which statement concerning the glycolytic and gluconeogenic pathways is correct? O A. Both are catabolic. O B. Both are anabolic. O C. Gluconeogenesis is catabolic while glycolysis is anabolic. O D. Gluconeogenesis is anabolic while glycolysis is catabolic. O E. Gluconeogenesis occurs in brain and glycolysis occurs in muscle. In lactic acid fermentation, which substance is oxidized and which is oxidized? O A. Lactate is reduced and NAD* is oxidized. OB. Lactate is reduced and pyruvate is oxidized. OC. Pyruvate is reduced and NADH is oxidized. O D. NADH is reduced and pyruvate is oxidized. O E. Lactate is oxidized and NADH is reduced.Cyanide poisoning inhibits aerobic respiration at cytochrome c oxidase. Which of the following is NOT a result of cyanide poisoning at the cellular level? Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a b с d e Oxygen is reduced to water The rate of glycolysis increases Cells are forced to switch to anaerobic respiration The electron transport chain is not completed None of the above Answered K Open in Reading View ✔Posubmit