Why are type II REs the preferred REs for molecular cloning? Othey cleave at fixed sites Othey cleave at a workable temperature range Othey always cleave 6-10 bp upstream the target Othey do not manifest star activity
Q: 5. What science governs nanostructures? Why is it different?
A: Nanoscience, or nanotechnology, studies and manipulates materials and phenomena at the nanoscale,…
Q: Gluconeogenesis requires how many NTPs (nucleotide triphosphates, i.e. ATP, GTP)? Group of answer…
A: Gluconeogenesis is a metabolic process that involves the synthesis of glucose from molecules that…
Q: Lineweaver Burk plot to determine the Vmax and Km
A: The Lineweaver-Burk plot, also known as the double reciprocal plot, is a graphical representation of…
Q: 15.3) In the previous problem, you drew the products for the phosphorylation of ADP reaction (shown…
A: ATP (adenosine triphosphate) is an important molecule in the cell that serves as a source of energy…
Q: Select the statement that is NOT correct O Most plasma lipoproteins are synthesised in the liver The…
A: Metabolism refers to the chemical processes that occur within living organisms to maintain life. It…
Q: Sort the following molecules based on their Gibb's free energy level, from high energy to low…
A: Gibbs's free energy is the amount of free energy available in a system or molecule to do work,…
Q: Consider the translation of the following mRNA base sequence below during protein synthesis and…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Why is oxaloacetate depletion from the TCA cycle important for the initiation of ketogenesis? What…
A: The TCA cycle is a central metabolic pathway that occurs in the mitochondria of cells and is…
Q: Hyaluronic acid
A: here is your solution Hyaluronic acid: Hyaluronic acid is a naturally occurring biopolymer…
Q: H3C CH3 1. After the whole fatty acid molecule is completely broken down, how many molecules of…
A: Beta oxidation is the breakdown of fatty acids into acetyl CoA and other products based on carbon…
Q: Draw a diagram of the anabolism pathway of Cystine and Cysteine.
A: Cysteine is a semiessential amino acid with a thiol group that participates in many biochemical…
Q: What is lipid phosporylation?
A: Phosphorylation is a chemical process that adds a phosphate group to a molecule, most commonly a…
Q: List the most likely cellular component or organelle that houses each of the following…
A: Proteins are high molecular weight polymers that serve diverse functional roles in cells. They…
Q: A 45 year old male presents to the ER after passing out at work. He works in a factory that produces…
A: Cyanide is a strong inhibitor of the electron transport chain (ETC), which is the final stage of…
Q: 12. In a sample consisting of three tripeptides (MDE, KRF, and RDY), which will be eluted last from…
A: The tripeptide MDE will be the last to be eluted from an anion exchange resin at pH…
Q: STUDYING 6 Statistical exercise: Corals and Temperature Science often involves gathering data. The…
A: The uncertainty or precision with the given samples is called a Standard growth estimate. It…
Q: 9. Scopolamine is an antagonist at which of the following receptors? a. nicotinic b. muscarinic c.…
A: Muscarinic receptors are found in various organs throughout the body, including the heart, lungs,…
Q: In which of these processes does a phosphoester, NOT break? a)ATP Hydrolysis b)Nuclease activity…
A: An ester bond formation is a condensation reaction between a hydroxyl group (-OH) and a carboxyl…
Q: 1. Which is false about metabolic regulation? A: reactions with a large negative delta G are likely…
A: Metabolic regulation is the control and coordination of metabolic pathways and processes within an…
Q: For the scenario below relating to Glycogenolysis, please explain how glucose release would be…
A: Glycogen is a macromolecule which acts as a storage of glucose in our body. It is a highly branched…
Q: draw a “trans” and a “cis” peptide bond of alanine and threonine with the peptide bond lying in the…
A: The angle between the two planes in a molecule is called as the torsional angle or dihedral angle.…
Q: State the steps of ketone body formation, starting with two acetyl CoA. Please make sure to state…
A: Acetyl-CoA formed during oxidation of fatty acids in the liver, either enter the citric acid cycle…
Q: Decylic acid is a saturated fatty acid that occurs naturally in coconut oil and palm kernel oil.…
A: We are given a saturated fatty acid containing 10 carbon atoms. Its catabolism starts with its…
Q: How many net ATP are produced from the complete oxidation of one molecule of 1,3-bisphosphoglycerate…
A: 1,3 -bisphosphoglycerate is an intermediate formed in the process of glycolysis. It is a three…
Q: What is the best advise for obtaining 2-log viral inactivation when the needed CT free chlorine is…
A: Various disinfectants are used to clean or free the water from microbes. The parameter which is used…
Q: If the Gibbs free energy change for the reaction; Succinate + FAD → Fumarate + FADH2 is -40KJ/mol at…
A: Gibbs free energy change (ΔG) is the energy change that occurs in going from the reactants to the…
Q: From your Lineweaver-Burk plot,the vlaues are: Km Vmax Uninhibited 0.09 mmol/L 3.02 min/mmol…
A: Enzyme inhibition is when an inhibitor binds to the enzyme at the active site or another site, which…
Q: . The induced fit conformational change in hexokinase occurs when— the allosteric site is…
A: Hexokinase is the enzyme found in the cytoplasm that catalyses the addition of phosphate to glucose…
Q: Can this standard curve be used for E. coli cells (why/why not?)
A: In biochemistry, a standard curve is prepared by plotting the known amounts/concentration of…
Q: fuel source under anaerobic conditions?
A: First we see what is meant by anaerobic conditionAnaerobic ConditionAnaerobic refers to a condition…
Q: Can you please re-draw this diagram again more clearly in a digital format
A: Alzheimer's disease is a neuronal disease caused due to abnormal build-up of proteins in and around…
Q: Using proper convention, provide the amino acid sequence for the following protein.…
A: Amino acids are referred to as the building blocks of proteins. A linear amino acid sequence forms…
Q: Which of the following molecules are nonpolar? proteins muscles cell membranes butanoic acid…
A: To determine if a molecule is polar or nonpolar, we need to consider the molecule's molecular…
Q: Explain the difference between ketogenesis and ketoacidosis.
A: Acetyl CoA produced from fatty acid oxidation in the hepatic cells has two possible fates: enter…
Q: Which step of glycolysis does citrate regulate (does it activate or inhibit that step?) 2. WHY…
A: Citrate is the product of the first step of TCA (Tricarboxylic acid ) cycle. High citrate…
Q: How many total ATP are REQUIRED to make 2 molecules of glucose in the liver via GNG starting with 4…
A: Gluconeogenesis (abbreviated as GNG) is the metabolic pathway that synthesizes glucose molecules…
Q: Create an experimental flow chart for the extraction of glucose-1-phosphate from starch.
A: Glucose-1-phosphate is a molecule consisting of a glucose molecule attached to a phosphate group via…
Q: strate about the Map and sequence the genomes of several model organisms used in experimental…
A: In genetics, molecular biology, and in various research genome mapping is important. It is basically…
Q: If D-glyceraldehyde-3-phosphate (DGAP) is dissolved in water, 96% of it will form dihydroxy-…
A: Triose phosphate isomerase (TPI) is an enzyme that catalyzes the reversible isomerization of…
Q: Why is this a meso conpound?
A: Meso compounds are are those that are not enantiomers. This means that the mirror image of a meso…
Q: Which enzyme do you think is defective, and why?
A: Hypotonia :As the name suggests, hypotonia is an underlying condition where muscles have a reduced…
Q: The effectiveness of allosteric effectors in regulating metabolic pathways is based on their ability…
A: Allosteric inhibition is the type of enzyme inhibition. In this, the working of the enzyme is…
Q: Which of these enzymes is NOT associated with the inner mitochondrial membrane? All of these enzymes…
A: Mitochondria is the power house of the cell. It has two membranes and a matrix. It even has its own…
Q: In which of the following metabolic conversions is ATP “generated” during glycolysis?…
A:
Q: 1. Using the structure of d-TMP show all the structural fragments donated by different organic…
A: The DNA is the deoxyribonucleic acid which is present in the nucleus of the cell. The DNA is a…
Q: how many ATP molecules are used and how many are made in total? A diagram summarizing the
A: Glycolysis is a key metabolic activity present in all living organisms. It takes place in the…
Q: You will be creating a concept map to illustrate the biochemistry unit studied in class. A concept…
A: Biochemistry is the study of various biomolecules chemical/metabolic processes that occur in the…
Q: Consider the structure of following peptide from human brain. Identify part of the structure which…
A: First, lets take a look at the structures of the 5 opioid compounds. Morphine Codeine Oxycodone…
Q: Given the following biosynthesis scheme, answer the questions (a)-(c) below. OH Me C E Me Me SACP OH…
A: For the synthesis of unbranched fatty acids, living beings carboxylate Acetyl CoA to yield malonyl…
Q: If you add enzyme to a solution containing only the product(s) of a reaction, would you expect any…
A: Enzyme is a biological catalyst, which is protein in nature, and can speed up the rate of a chemical…
Step by step
Solved in 3 steps
- Antisense RNA If MRNA is produced using this plasmid, what changes would result in production of an antisense RNA? Gene A Promoter McGraw-Hill Educston Check All That Apply No change is necessary because the MRNA Is the antisense RNA. The promoter must be moved to the other slde of Gene A. The antisense DNA must be Inserted Into the plasmid. Reverse the direction of Gene A In the plasmid.pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:vvnicn the following statements are correct about the repair of a DNA duplex containing the sequence below that is grown INE coli (select all that apply)? Strand A Strand B GATCTAGCCGGCATCCGAT CTAGATCGGACGTAGGCTA Methyl ✔A. MutH cleaves Strand A O B. DNA repair will result in the bold A in strand B being replaced with a C O C. DNA repair will result in the bold G in strand A being replaced with a T ✔ D. Defect will not be properly repaired in dam(-) E coli O E. The mammalian repair system would also correct the mismatch shown based on the methylation status of the DNA
- Gel electrophoresis separates molecules based on size O charge O weight What is the restriction cut site for HaellR ATAT GGCC O AATTAA O CGGGCOne of the frist steps in isolating plasmid DNA via mini-prep is to pellet the cells after O/N culture and then resuspend them in buffer P1. What's the point of pelleting the cells just to resuspend them again? To concentrate the cells P1 is a buffer, preventing small changes in pH O This step is not absolutely necessary P1 begins the lysis process D Question 2 What would happen if we didn't centrifuge the tube containing lysed cells after adding neutralization buffer and instead just added right to the column? O We could fihish the prep but we would have protein/RNA contaminants at the end O The precipitate is less dense than water so it shouldn't get in the way since it floats on top O The precipitate would obstruct the column and our prep is ruined O Our yield would be reduced, but we'd get somethingSupercoiling of DNA requires GTP as source of energy is only observed in prokaryotes is not observed in eukaryotes requires the action of topoisomerases
- What type of molecule or cell is PGLO? C Origin region Arabinose operon arac ori Ndel Promoter PaaD PGLO (5,400bp) Ndel Ampicillin Resistance Gene Amp Hindll Ndel Green Fluorescent Protein (GEP) Gene Hindll 'ECORI GraphiceESchmid/2003 D O virus O RNA plasmid molecule O DNA plasmid moelcule O none of the choices are correctSal1 Xho1 Insert pUC cloning vector MCS Insert Digested with Sal1 on the left and Xho1 on the right Sal1 Ori Vector Digested with Sal1 Xho1: СТСGAG Sal1: GTCGAC RE cut site Part B) After 8 h of sleep, you realize your mistake above (Question 3 Part A), and you successfully transformed your plasmid and obtained a subset of white colonies and blue colonies on the plate. Question: You conclude that all the blue colonies contain a plasmid O With the insert in the LacZ screening marker With the insert in the Antibiotic selectable marker O Without an insert in the LacZ screening marker O None of the above + Lacz alpha AmpRSynthetic polylinker Hindill EcoRI sticky end 5 AATTCCTGCAGAAGCTTCCGGATCCCCGGG CITAA Plasmid cloning vector (cleaved with Eco) GGACGTCTTCGAAG GCC TAGGGG CCCTTAA AATTC Psti Hindi Nelson & Co, Leninger Principles of Biochemistryde ©2021 WH Freeman & Company BamHI Smal EcoRI sticky end Enzyme Polylinker transferase; 2 ligase; 6 lyase; 6 lyase; 4 ligase; 4 BamHi Smal CITAAG GRATT C EcoRI Which pairing correctly matches the enzyme class and Enzyme Commission number for the enzyme that catalyzes this reaction?
- which of the following 's lave thue about RT-apcR? a) Floure scent chemiical is added in the Process and the fluorescent fignal is detceled only over once at last pce y ce The most important features. that eference have shold all samples is steple expression gene in The amount of template sequence Can se C) original Sample quanti fied in RT-9pcR the D: ff. re feren ce gee4.valuy Ca in tes ting fefertnce fample voiafio2 amouts iu the are due to fficien cy of CONA ryn they's. aeAlu 1 EcoRI ori pKY Bgl I Tet: Tetracycline resistance gene A. What would be the donor organism to be used in this cloning? B. How would you make sure you only get your gene of interest (EGF) from donor but nothing else? C. How do you put EGF gene into pKY plasmid? What is the best RE to use when inserting the gene into pKY plasmid? What happens if you use the enzyme Bgl I to insert the gene of interest? How does it affect your cloning result? D. How do you make sure you only grow E.coli that have the gene of interest?Conventional ligation procedures make use of enzymes with which activity? backbone nick repair O single stranded repair O double stranded repair O proofreading mechanism
