Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic code would turn out to be composed of triplet sequences and be non-overlapping?Experimentally, how were these suppositions shown to be correct?

Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic code would turn out to be composed of triplet sequences and be non-overlapping?Experimentally, how were these suppositions shown to be correct?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 10QP: What percentage of the DNA in the genome actually corresponds to genes? How much is actually...

See similar textbooks

Related questions

Q: If you were to compare the amino acid sequences of histone proteins across several distantly-related…

A: The histone proteins highly basic protein found in the nucleus of eukaryotic cells. They play a…

Q: What are the known exceptions to the genetic code?

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases…

A: In eukaryotic organisms, the gene contains introns as well as exons. Eukaryotic genomes are much…

Q: What is meant by “Universality and Degeneracy” of the Genetic Code? What is the significance of the…

A: DNA have four bases, A, T, G and C, and proteins are made up of 20 different amino acids. Thereby…

Q: What are the best available databases for identification of alternatively spliced isoforms in human…

A: Genome sequencing means to determine the whole DNA sequence of the particular organism like the…

Q: Introns in eukaryotic protein-coding genes may be quite large, but almost none are smaller than…

A: An intron is any nucleotide sequence within a gene that is removed by RNA splicing during maturation…

Q: If the MC1R protein is 317 amino acids long, why are there 954 base pairs in the coding region of…

A: The proteins are produced by the amino acids that are produced by the translation process. During…

Q: Assuming alternative splicing can generate all permutations and combinations. How many proteins…

A: Eukaryotes undergo ways of RNA processing after translation i.e. formation of mRNA from their DNA…

Q: What is a histone variant?

A: Proteins are large biomolecules consisting of one or more long chains of amino acids residues.…

Q: What does “Universality and Degeneracy” of the Genetic Code mean? State the significance of both the…

A: The genetic code is said to be nearly universal. It means that a given codon specifies the same…

Q: What proportion of exons are repeated sequences in the human genome? Is 38% surprising?

A: Human Genome is comprised of only 1.1% exons of the total, whereas 24% is in introns, and the…

Q: What are the known exceptions to the genetic code?

A: Genetic code: Genetic code is the term wherein each three nucleotides (out of four) in a row is…

Q: Why can't the RNA leader form the terminator in the 2-3 stem loop configuration and what happens as…

A: The question is the part of the tryptophan operon and attenuation. Attenuation is a mechanism for…

Q: What is the Evidence for a triplet code?

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Why is the term “proteome” ambiguous, whereas the term“genome” is not?

A: The proteins are the essential part of living organisms and it consists of thousands of smaller…

Q: If you wanted to study the nature of transcription in yeast under aerobic versus anaerobic…

A: Yeast grows differently under aerobic and anaerobic conditions. To study the nature of transcription…

Q: What do you mean by cross-exon recognition complex ?

A: CROSS - EXON RECOGNITION COMPLEX : The sequence of DNA present in mature messenger RNA some of which…

Q: What molecular biology strategy can best be used to determine Inhibition of the splicing of one…

A: In eukaryotic genes, introns exist. They are interstitial sequences (80-10,000 bp). They do not code…

Q: What causes trinucleotide repeat expansion?

A: Trinucleotide repeat expansion or triplet repeat expansion refers to the mutation of DNA consisting…

Q: What are some reasons why, in multicellular eukaryotes, genome size is not necessarily related to…

A: Plants, animals, and microbes constitute the living world. The organisms, based on the cell type,…

Q: Define FOUR (4) types of point mutations within coding sequences

A: Coding sequences are the sequence of nucleotides in DNA capable to produce a protein. Many mutations…

Q: What are Exceptional genetic codes?

A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…

Q: Approximately what portion of the human genome is composed of repeat sequences?

A: According to the results found in the human genome studies it is seen that the human genome has…

Q: Explain why it is sometimes difficult to locate genomic regions that encode a protein.

A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…

Q: Why can the genetic code be qualified as a “degenerate code”?

A: The genetic code is referred as the nucleotide sequence of nitrogenous base, which specifies the…

Q: How many possible mRNAs could be derived from a gene with three exons (exon 1, exon 2, and exon 3)?…

A: Transcription is a process in which one strand of DNA known as template strand is known as converted…

Q: Do you think that the alternate splicing of exons may enable a structural gene to code for several…

A: Alternative splicing is a basic regulatory process of gene expression. This process is very…

Q: Introns in protein-coding genes of some eukaryotes are rarely shorter than 65 nucleotides long. What…

A: Unconstrained DNA sequence which are those sequences whose evolution is unaffected by selection are…

Q: There are characteristic differences in the nucleotide sequences of the leading and lagging strands.…

A: Deoxyribonucleic acid(DNA) is a molecule that contains two polynucleotide chains that coil around…

Q: Why is the genome contained within a membrane?

A: A genome is a complete set of "genetic information" in an organism. It stores all of the information…

Q: The genomes of most multicellular eukaryotes encode~25,000 genes, yet their proteomes contain over…

A: Genes are the stretch of the DNA that codes for the polypeptide chain during the process of gene…

Q: What general characteristics are found in many transposable elements?

A: Transposable elements are also known as jumping genes or transposons. A transposon is a segment of…

Q: Which of the following snRNPs facilitate the second transesterification reaction during mRNA…

A: snRNA is a class of little RNA particles that are found inside the splicing regions and Cajal bodies…

Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…

A: DNA is double-stranded, but only one strand serves as a template for transcription at any given…

Q: Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than…

A: Genetic code is defined as the set of nucleotides which determine the sequence of DNA of a given…

Q: Where does RNA processing fit into the central dogma of molecular genetics?

A: The central dogma is the process which governs the gene expression. A gene is expressed when an mRNA…

Q: What are genetic codes with suitable examples?

A: Genes are the basic structural and functional unit of heredity. They carry coded genetic information…

Q: Why has the code remained nearly invariant through billions of years of evolution, from bacteria to…

A: The genetic code includes the set of rules according to which the information present in genetic…

Q: Why is the identification of genes for noncoding RNAs more difficult than the identification of…

A: Coding RNAs are responsible for coding proteins, while non-coding RNAs do not code for proteins.…

Q: What feature of the –10 sequence makes it easy to unwind?

A: Pribnow box, or -10 sequence represents the six-nucleotide-sequence TATAAT. This sequence is a…

Q: What is a polycistronic mRNA? How are polycistronic mRNAs formed?

A: Answer:Introduction: Polycistronic mRNA means messenger RNA means mRNA containing data for the…

Q: what is Composite transposon

A: Transposons are the DNA sequences capable of changing its position or location within the genome of…

Q: Computer programmers, working with molecular geneticists, have developed programs that can identify…

A: Transcription is the process by which the information in a strand of deoxyribonucleic acid (DNA) is…

Q: Why is alternative splicing beneficial?

A: The biological process that refers to the formation of a gene to able to code for multiple proteins…

Q: What is a nucleosome-free region? Where are such regions typically found in a genome? How are…

A: Given: Explain about the nucleosome-free region. and explain such regions typically found in a…

Q: What is the minimum length of time required for the synthesis by E. coli polymerase of an mRNA…

A: The transcription of an mRNA encoding a 100-kDa protein by E. coli polymerase is known as…

Q: Suppose we take tissue samples from the kidney and the liver of a healthy individual. If we compare…

A: Genetic sequences or the genome of a cell is present in the nucleus and includes DNA molecule…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

You are studying a large eukaryotic gene that is 439,515 base pairs long. You find the polypeptide that this gene produces in liver cells is 46,771 amino acids long. Your colleague studies the function of this gene in brain cells, and finds the polypeptide produced in the brain is much larger – 61,438 amino acids long. How do you explain this difference? Possible Answers: A. The cell cycle of liver cells is much longer than that of brain cells. B. This is due to alternative splicing. in the brain C. There was a different complement of sequence-specific transcription factor binding sites in the CRM of the brain cells. D. There is no 5' cap added to the gene product from the liver cells.
What is the concept of universality of the genetic code? What are the exceptions to this universality?
Describe the outcome of a chain-terminator sequencing procedure in which (a) too few primers are present or (b) an excess of primers is present.
Which of the following set(s) of primers a-d could you use to amplify the following target DNA sequence, which is part of the last protein-coding exon of the CFTR gene? Explain briefly. (Note: The three dots represent the body of the region to be amplified, whose beginning and end are only being shown.) 5' GGCTAAGATCTGAATTTTCCGAG . TTGGGCAATAATGTAGCGCCTT 3' 3' CCGATTCTAGACTTAAAAGGCTC . AACCCGTTATTACATCGCGGAA 5' a. 5' GGAAAATTCAGATCTTAG 3'; 5' TGGGCAATAATGTAGCGC 3' b. 5' GCTAAGATCTGAATTTTC 3'; 3' ACCCGTTATTACATCGCG 5' c. 3' GATTCTAGACTTAAAGGC 5'; 3' АССCGTTATTАСАТСGCG 5 d. 5' GCTAAGATCTGAATTTTC 3'; 5' TGGGCAATAATGTAGCGC 3'
Your advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she suggests that you write a computer program that will identify the exons of protein- coding genes directly from the sequence of the human genome. In preparation for that task, you decide to write down a list of the features that might distinguish protein- coding sequences from intronic DNA and from other sequences in the genome. What features would you list?
A 2500 bp region of the human genome encodes two genes. One of the genes encodes a protein of 600 amino acids and the other gene encodes a protein of 280 amino acids. The mRNA sequences of the two genes do not contain any of the same nucleotide sequences (i.e. they do not overlap). How is this possible? Fully explain your answer.
The abundance of three mRNA transcripts, transcripts A, B, and C, was measured by real-time PCR. The average CT values were 14.6, 20.2, and 10.5 for transcripts A, B, and C, respectively. Determine the relative order of abundance of the transcripts. Name one technique that could be used to confirm that the order of abundance at the mRNA transcript level is reflected at the protein level.
As we focused on the genetic code and the transcription of genetic information stored in DNA into complementary RNA molecules. Along the way, we found many opportunities to consider the methods and reasoning by which much of this information was acquired. From the explanations given in the chapter, what answers would you propose to the following fundamental questions: Question: How do we know that the initial transcript of a eukaryotic gene contains noncoding sequences that must be removed before accurate translation into proteins can occur?
In the table below, there are four versions of gene A, one of which is normal, and the other three which contain mutations that make the gene product nonfunctional. Focus on the shaded region of the sequence. Use the genetic code table to answer the question. How would you describe Mutation #2? Partial DNA sequence for gene A ("..." indicates many nucleotides of sequence not shown) 5' ... ATG GTG AGC AAG GAG GAG CTG TTC ACC TGT AAA TAG ... Normal Mutation #1 5' ... ATG GTG AGC AAG GAG AAG CTG TTC ACC TGT AAA TAG ... Mutation #2 5' ... ATG GTG AGC AAG TAG GAG CTG TTC ACC TGT AAA TAG ... Mutation #3 5' ... ATG GTG AGC AAG GAG CTG TTC ACC TGT AAA TAG ... Silent mutation Nonsense mutation Frameshift mutations Missense mútation
In genetic transformation, what is meant by the wordcompetence?
Although DNA transposons are abundant in the genomes of multicellular eukaryotes, class 1 elements usually make up the largest fraction of very large genomes such as those from humans (~2500 Mb), maize (~2500 Mb), and barley (~5000 Mb). Given what you know about class 1 and class 2 elements, what is it about their distinct mechanisms of transposition that would account for this consistent difference in abundance?
In your own words, What is meant by “Universality and Degeneracy” of the Genetic Code? What is the significance of the code’s Universality? Degeneracy?