Q: What is the average number of alleles for Population 2? Population 1 Population 2…
A: A gene, a heritable component that regulates a particular characteristic of an organism, is known as…
Q: The lacZ gene from E. coli encodes the enzyme B-galactosidase, which catalyzes conversion of a…
A: Recombinant DNA technology deals with changing the DNA sequence of the organisms. The molecular…
Q: What pathway(s) via which that ion could be taken by plant roots?_____________ A. Apoplast B.…
A: Introduction The majority of plants obtain the water and nutrients they require from their roots.…
Q: 1. The community and abiotic factors in a contagious area._____ 2. Transformations of energy always…
A: Ecology is the study of the interactions between the ecosystem's living and non-living parts. The…
Q: f populations of white rhinoceros (Ceratotherium simum) continue to decline, one approach to prevent…
A: A species that is threatened with extinction in the near future, either globally or within a certain…
Q: ANSYS Fluent : how to construct a geometry, mesh, simulate gas and aerosol, post processing, and…
A: The Ansys Fluent it is a general purpose of the computational fluid dynamics (CFD) software is used…
Q: 3. Despite your chaotic nature, you various types of RNA species (molecules) following their…
A: rRNA is a ribonuclic achid which is synthesized inside the nucleus of the cell.
Q: 1. What is the purpose of photosynthesis? 2. Where is photosynthesis performed inside of eukaryotic…
A: The plants are the autotrophic organisms. These make their own food.
Q: Review the organisms classified below. Identify the two organisms that are the most closely related.…
A: Classification is the process where we can categories something into a group based on their certain…
Q: The Cenozoic Era As you do the lab, fill in the last two columns for the Paleocene through the…
A: Introduction Evolution is the process by which different species are evolved over time in response…
Q: 1. In the 1950s, many scientists thought that proteins, not DNA, carried genetic information. a. Why…
A: Note:- Sorry, as per the honor code we are allowed to author only the first three questions unless…
Q: In the dark, rod cells are unstimulated and therefore the sodium is able to enter and depolarize the…
A: Introduction Rod cells are one type of photoreceptor cell found in the retina of the eyes.…
Q: What factors determine whether pyruvate carboxylase acts primarily as an anaplerotic or a…
A: pyruvate Carboxylase is an enzyme that is involved in gluconeogenesis and that adds bicarbonate to…
Q: True or False: A cell plate forms in cytokinesis in plant cells. True False Maybe
A:
Q: If the natural log of overall fitness (rather than just juvenile survival) was graphed on the…
A: The juvenile stage of any specie is the stage before attaining the vegetative stage. Juvenile…
Q: Put the event of hemostatasis in order 1. Vascular spasm 2. Formation of platelet 3. Conversion of…
A: The process that causes a blood vessel to stop bleeding is known as hemostasis. It is a procedure…
Q: Classify each of the characteristics based on whether it describes autotrophs or heterotrophs.…
A: Food chain involves the transfer of energy from one trophic level to the other trophic level.On the…
Q: Hazardous wastes can be disposed of using Incinerator Injection well Landfill All of the above…
A: Question 14. The activated sludge is a process with concentration of microorganisms, basically…
Q: F ST A E BC
A: We know that The hypothalamus and the pituitary gland are part of the neuroendocrine system. The…
Q: Cadherin molecules are adhesion molecules found on the cell surface. These molecules are often…
A: Introduction :- Cadherins are transmembrane proteins in mammals that mediate cell-cell adhesion.…
Q: what of the following is more likely to speed up the loss of telomeric repeats? a.Tetreplex DNA…
A: Since DNA bases are mainly planar and moderately hydrophobic, they tend to stack parallel to one…
Q: What are the advantages and disadvantages of viable cell counts and turbidimetric method?
A: There are various methods devised to determine the number of microbes in a sample .It may includes…
Q: Problem 4: Here are four human pedigrees. The black symbols represent an abnormal phenotype…
A: Pedigree used to construct to describe traits in the several generation without using any molecular…
Q: List the four molar types in mammals and what they are adapted to process (what do these animals…
A: Mammals generally have four tooth types. These four are known as incisors, canines, premolar, and…
Q: Work 1. Vascular-platelet hemostasis The endothelial cell Circulating platelets O do ADP secretion…
A: Vascular platelet homeostasis is a primary homeostasis in which our body forms a temporary plug to…
Q: Provide FOUR (4) positive and TWO (2) negative contributions of microorganisms on food security.
A: The comprehensive research of microorganisms, whether they have one cell, many cells, or are…
Q: 13. Which of these statements concerning the symport of glucose into cells is true? Understand a.…
A: Molecules or ions need to be transported along their membranes the maintain their concentrations…
Q: Is it just one hair cell or is it technically three 'cells' per hair cell: afferent neuron, senesory…
A: We have two types of hair cells, the outer hair cells and the inner hair cells in our ears. Outer…
Q: Explain the evolution and the modification of fish's internal and external structure.
A: The evolution of fish began about 530 million years ago during the Cambrian explosion. It was during…
Q: Discuss two direct methods in determining microbial population. Discuss it comprehensivel
A: Microbes are the organisms which are very small in size,usually microscope is required to observe…
Q: Draw the reaction mechanism then identify the reaction mechanism that took place, SN1, SN2 and etc.…
A: SN1 Reaction is a nucleophilic substitution reaction with a unimolecular rate-determining step.…
Q: Based on what you know on how ultrasound imaging works, what do you think will NOT look like a black…
A: Diagnostic ultrasound, also called sonography or diagnostic medical sonography, is an imaging method…
Q: How can a drug influence the immune system? In your answer also include an example for each…
A: Immune system consists of various immune cells and various types of immunity against the outside…
Q: SIGNALS AND TARGETS. Listed below are sample polypeptides/proteins with their signal…
A: Signal recognisation sequence are the sequence that are responsible for transporting the particular…
Q: The graph monitors antibody titer over time in a patient. What is happening at time d? Antibody…
A: Introduction An organism's immune system is a network of biological organs and mechanisms that…
Q: What is the evolutionary advantage of bacteria that have flagella vs. bacteria that do not?
A: Flagella is a hair-like structure found in many microorganisms (including bacteria) that allows them…
Q: 성
A: Division Chlorophyta Class Phaeophyceae Order Fucales Family Sargassaceae Genus Turbinaria…
Q: You are studying how a newly discovered virus in bats enters their cells. When you examine cells…
A: Virus is a microscopic organism it is not though made up of a complex structure as it has only…
Q: What happens when two amino acid molecules form a bond to build a protein? release of a carbon…
A: Introduction: Protein; Amino acids are arranged in a long chain and joined to one another by…
Q: How did Charles Darwin came up with the tree of life? Explain
A: Charles Darwin: Charles Darwin was a British naturalist. After his voyage on HMS Beagle,…
Q: Explain transplantation (tissue) rejection and provide examples.
A: Introduction :- Acute rejection occurs when the new organ is attacked by the body's immune system…
Q: Describe three (3) principal ways in which immune system fails
A: There are many reason for the immune system failure. Described in following.
Q: the paper “Four Legs good, Two Legs Fortuitous...” what were the selective pressures that drove…
A: The statement describes that 4 legs that is being quadruped is an adaptations that make them…
Q: The post-translational OA. is performed by OB. is removed by phosphatases. OC. can activate or in…
A: Translating a code simply involves changing it from genetic code to proteins. The initiation and…
Q: rrect? Choose one: O A. After they shed their coats, ER vesicles fuse together in a process known as…
A: The fusion of membranes of the same compartment is known as homotypic fusion whereas the fusion…
Q: 4. Below each item, identify WHAT it is, indicate WHERE in the chloroplast it is used/made, identify…
A: The plants that are maintained in the sunshine have a better chance of survival since the plant can…
Q: The adaptive specific immune response is more complex than the innate response. Discuss ways in…
A: Human immune system is a complex system that provide the resistance against the diesease and any…
Q: Ⓒ Macmillan Learning According to the biological species concept definition of a species, what…
A: In the ecology species is the unit. Group of organisms of same species that are located in a…
Q: If an individual with Type B+ requires a blood transfusion, list out the specific blood types that…
A: Blood transfusion is a blood transfer process in which an individual donates blood to the recipient…
Q: a. List genotypes of as many of the family members as possible. b. If individuals A and B marry,…
A:
Please number the bullets
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- EcoRI recognizes GA-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? -'3 5'-AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCCYou are interested in amplifying the putative gene encoding the 480-bp protein TMR (Total Memory Recall) from a much larger DNA sequence you have been given. Parts of the gene are shown below. internal region ATCGGA 5' .GCTGAC. 3' ...CGACTG. .CGTTAG.. - 3' TAGCCT.. .GCAATC...... - 5' What reagents would you put into your PCR to amplify the above sequence? (Circle all that apply.) a) primer: 5'-GCTGAC-3' i) DNA polymerase b) primer: 5'-CGACTG-3'j) RNA polymerase c) primer: 5'-CGTTAG-3' k) DNA ligase d) primer: 5'-GCAATC-3' l) reverse transcriptase e) primer: 5'-GTCAGC-3' m) MgCl, f) primer: 5'-CAGTCG-3' n) NTPS g) primer: 5'-GATTGC-3' h) primer: 5'-CTAACG-3' 0) DNTPS p) ribosomesTranscribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5' GCAUGCACAUAGGGUAGG 3' 5' GCAUGCACAUAGGGUAGG 3' 3' CGUACGUGUAUCCCAUCC 5' 5' GCATGCACATAGGGTAGG 3' 3' CGTACGUGTATCCCATCC 5'
- A selectable marker is used in the section of recombinants on the basis of their ability to produce colour in presence of chromogenic substrate.(a) Mention the name of mechanism involved.(b) Which enzyme is involved in production of colour?(c) How is it advantageous over using antibiotic resistant gene as a selectable marker?EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC -¹3The technique of fluorescence in situ hybridization (FISH) is described. This is another method for examining sequence complexity within a genome. In this method, a DNA sequence, such as a particular gene sequence, can be detected within an intact chromosome by using a DNA probe that is complementary to the sequence.For example, let’s consider the β-globin gene, which isfound on human chromosome 11. A probe complementary to theβ-globin gene binds to that gene and shows up as a brightly colored spot on human chromosome 11. In this way, researchers can detectwhere the β-globin gene is located within a set of chromosomes. Becausethe β-globin gene is unique and because human cells are diploid(i.e., have two copies of each chromosome), a FISH experimentshows two bright spots per cell; the probe binds to each copy ofchromosome 11. What would you expect to see if you used thefollowing types of probes?A. A probe complementary to the Alu sequenceB. A probe complementary to a tandem array near…
- Interrupted mating experiment between Hfr and F strains can be used to map the bacterial genes. In the following experiment, an Hfr strain X (azi' gal" gly" his lac leu' thi" thr' str' ton') was mixed with the F strain which is auxotrophic for threonine (thr'), leucine (leu'), glycine (gly), and histidine (his'), is resistant to streptomycin (str), but is sensitive to sodium azide (azi"), and to infection by bacteriophage TI (ton'), and is unable to ferment lactose (lac') or galactose (gal). At various time intervals, small aliquots were removed and mixed violently to separate the conjugating cells. The samples were then plated onto selective media to measure the frequency of thr' leu' str recombinants. It was learnt that thr and leu were very close to the origin of replication and str was quite distant from the origin of replication in the Hfr chromosomal DNA. The results obtained are illustrated in the figure below. azi ton lac gal his gly 5 10 15 20 25 30 35 Time of conjugation…. Propose a mechanism by which a type II topoisomerase could use the energy of ATP hydrolysis to scan a large DNA molecule and, thereby, to direct that the enzyme will catalyze largely “disentan- gling" reactions (decatenation and unknotting).The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA is: A) 5’UCCUACGUGCAUG3’ B) 5'AGGATGCACGTAC 3’ C) 3’UCCUACGUGCAUG5’ D) 3’AGGAUGCACGUAC5’ E) 5’AGGAUGCACGUAC3’
- 4- Some/ one application(s) for DNA are/ is.... and they/ it start(s) from the mRNA. Therefore, the reverse transcriptase enzyme is required: a) DNA sequencing b) Electrophoresis c) Microarray d) All of the abovea. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =Provide a brief description behind your choice? Virus-mediated transfer of cellular genetic material from one bacterial cell to another by means of virus particles is called: (A) transduction (B) transposition (C) transformation (D) transfection One strand of double-stranded DNA is mutated, changing all cytosines to uracils. After one round of replication of the mutated DNA strand, the melting temperature of the resulting DNA will: (A) be higher (B) be lower (C) remain the same (D) be double The Southern blotting technique is used for: (A) the detection of RNA fragments onmembranes by specific radioactiveantibodies (B) the detection of DNA fragments onmembranes by a radioactive DNAprobe (C) the detection of proteins on membranesusing a radioactive DNA probe (D) the detection of DNA fragments onmembranes by specific radioactiveantibodies Superoxide dismutase is an important enzyme for maintenance of red blood cells and is defective insome neurodegenerative diseases. What…