Why is folding in the ER slow and inefficient and how are the misfolded ones degraded?

Q: Why did RNA silencing develop?

A: RNA silencing or RNA interference is a process of post-transcriptional gene regulation. It is a…

Q: What does the allostery of the regulatory protein enable?

A: The catalysts that are present in the livings cells are called enzymes. The enzymes are protein…

Q: What is the result of too much Antp protein?

A: This is one of the proteins present in Drosophila. Overexpression or underexpression of any protein…

Q: Why are misfolded proteins a potential problem for the eukaryotic cell, and how do cells combat the…

A: Eukaryotic cells can be defined as the cells that are complex in terms of structure and function as…

Q: What are the mechanisms by which regulation bysRNA occurs?

A: RNA (ribonucleic acid) is a polymer of nucleotides and is composed of a pentose sugar, a nitrogen…

Q: Why is the differentiation of oocytes a great model for studying protein localization?

A: Protein localization is a process in which proteins gets accumulated in any particular location to…

Q: How did the back mutation in hisG affect the protein produced by this gene?

A: Back mutation or backward mutation is a kind of mutation which leads to reversion of the mutated…

Q: Explain why mutations occur in the CFTR?

A: The CFTR gene provides instructions for making a protein called the cystic fibrosis transmembrane…

Q: List five proteins that interact with the CFTR protein.

A: Proteins that interact with CFTR protein.

Q: What is the major function of a Src homology-2 (SH2) domain?

A: It is a structurally conserved protein domain contained within the Src oncoprotein and present in…

Q: What is the molecular mechanism that retains SCAP–SREBP in the ER when cholesterol is present but…

A: The complex of SCAP and SREBPs migrates to the Golgi complex when "sterol levels decline not when…

Q: which Mechanisms Limit TransposableElement Movement?

A: Transposable elements, also known as jumping genes are short segments of DNA, which have special…

Q: What is the protein-coding region? where it is found?

A: Introduction  DNA and RNA are the main genetic material found in all the species irrespective of…

Q: How is the Mc1R gene synthesized from chromosomes and how does it produce itself into a melanocortin…

A: A DNA molecule comprises functional units called genes. Each gene provides instructions for a…

Q: How does alternative splicing affect TRNT1?  What evidence do you have?

A: TRNT1 is a tRNA-nucleotidyltransferase 1 enzyme coded by gene TRNT1 in human. It helps to provides a…

Q: Where on the ribosome do tRNAs bind, and what isthe energy source that supports translocation?

A: Ribosomes are the protein factories of the cells and are the sites where the process of protein…

Q: How chromatin remodeling and chromatin modifications are necessary to make cis-acting regulatory…

A: In past few years, for the identification and characterization of the ATP-dependent…

Q: What is the relationship between the Golgi apparatus and the ER in a protein-secreting cell?

A: A cell is the functional unit of life. It is a membrane-bound structure and consists of a cell…

Q: What factors can promote protein misfolding in cells?

A: A cell is the basic structural and functional key of life. A cell has multiple organelles that carry…

Q: What is the process that directs the ribosome synthesizing a protein destined to enter the ER to…

A: There are two types of endoplasmic reticulum: 1. SER. (Smooth Endoplasmic Reticulum ) 2.RER (Rough…

Q: function of a Src homology-3 (SH3) domain?

A: Amino acids can be defined as the building blocks that form polypeptides and ultimately proteins.…

Q: What are elements of role transition from RN to APN?

A: RN is an abbreviation for Registered Nurse and APN is an abbreviation for Advance Practice nurse.

Q: How does the CRP mechanism contribute? Where does it come from?

A: Inflammation is a defence process carried out by the immune system in which the entry of the antigen…

Q: Give the structure of an LTR retrotransposon ?

A: DNA or deoxyribonucleic acid is a type of nucleic acid present in the nucleus of the cell. It is the…

Q: How does gene expression change over time for the polypeptide components of hemoglobin?

A: There is a change in the polypeptide chains of the hemoglobin from the fetus till birth.

Q: What is the Membrane attack complex (MAC)?

A: MAC stands for Membrane attack complex. It is also known as the terminal complement complex. MAC is…

Q: Is cDNA double or single stranded?

A: The central dogma of molecular biology is that DNA is replicated and then it undergoes transcription…

Q: How do loss of function mutations associated with Artemis (protein) cause their resulting…

A: Introduction: -Artemis is a protein that in humans is encoded by the DCLRE1c gene.  Function: -…

Q: How do the A, P, and E ribosomal sites differ functionally during protein synthesis?

A: Protein synthesis is a cellular process through which cells produce polypeptide chains (proteins)…

Q: How do these fragments relate to the three-dimensional structure of whole IgG molecules?

A: Introduction: The immune system is a complex cell/tissue network that protects our body from any…

Q: components that are part of the synthesis of T3 T4?

A: Thyroid hormones are produced by thyroid glands which consists of thyroid follicles serving both as…

Q: Results of dsx splicing when tra is present?

A: Splicing is the process of removal of non coding sequences called intron from the pre mRNA…

Q: What is RNA-binding proteins (RBPs) ?

A: RBPs expands for RNA-binding proteins. These are the proteins that have the tendency to bind to…

Q: What are the relative amounts of the different splice forms and chemically modified forms (e.g.,…

A: Golgi do post-translational modifications in protein. Such as attaching carbohydrates…

Q: What is unique about the translocation of ER proteins into the ER lumen vs. the translocation of…

A: Transport proteins function as cell doors, allowing certain chemicals to flow back and forth across…

Q: What events does the RecA protein facilitate?

A: Introduction  DNA strands is composed of nucleotide base pairs sequence such as Adenine, guanine…

Q: GGGAGTGTATACGGGATGAAGGCATT MRNA: Protein And the phenotype?

A: Proteins are translated from mRNA which result into specific functions or phenotypes.

Q: What sequence information about a gene is lackingin a cDNA library?

A: Genetics is the branch of biology, which deals with the study of genes, their pattern of…

Q: What are the Results of tra splicing when Sxl protein is present?

A: Alternative processing is a process that is a part of gene regulation and results in a single gene…

Q: How do sRNAs alter the translation of target mRNAs?

A: Introduction: Small RNAs or sRNAs produced by bacteria are 50-500 long nucleotide sequences that are…

Q: what are the functions of 'sig' and 'S protein_mut'?

A: A gene is a genetic molecule that is passed down from one generation (parents) to the next…

Q: How, the immediate translated product is transported from cytoplasm to the ER ?

A: Translation is the process of formation of amino acids using mRNA as a template.

Q: Why are suppressor tRNA mutation not lethal

A: Mutation is defined as sudden inheritable change that occurs in the DNA sequence. It may be…

Q: How do RER and SER differ from one another in terms of structure and function? List the processes in…

A: A cell is the basic key of life that is capable of performing all the functions of life and also…

Q: Is cDNA more stable than RNA?

A: RNA or ribonucleic acid is a polymer of ribonucleotides connected together via a phosphodiester…

Q: What is the function of the spliceosome in hnRNA?

A: Introduction- Eukaryotic hnRNA is known as heterogeneous nuclear RNA that forms cytoplasmic mRNA in…

Q: How are actin-regulatory proteinscontrolled spatially in the cytoplasm togenerate multiple distinct…

A: Actin is one of the most important proteins in the cell, playing a major role in cell motility,…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.