Q: Athlete's foot is caused by: O A. insect O B. fungus O C. bacteria O D. virus
A: Athlete foot is a skin infection that usually begins between the toes. It commonly occurs in the…
Q: Elaborate on the statement “embryonic development involves both activation and inhibition”. Support…
A: Embryonic development involves both activation and inhibition.
Q: . A defective white blood cell does not complete the process of DNA replication. Which of the…
A: In order for the replication of DNA to occur there is a definite sequence of cell cycle that has to…
Q: Most land animals with exoskeletons are smaller than the volume of a mouse, and most vertebrates are…
A: Insects belong to the phylum Arthropoda and it is the largest phylum in the animal kingdom…
Q: To describe: The three ways in which metabolic pathway can be regulated.
A: A metabolic pathway is a series of interconnected biochemical reactions that convert a substrate…
Q: rostaglandin-endoperoxide synthase 2, also known as cyclooxygenase- or COX-2, is an enzyme that in…
A: Prostaglandins directly act upon nerve endings to induce pain. They may also speed up the process of…
Q: 2
A: 1.Blastocoel 2. Blastopore 3. Mesenchymal cells 4. Animal pol
Q: Study the diagram below to identify the pressure relationships which are present during VENTRICULAR…
A: During first part of ejection ventricular pressure rises blood is intensively ejected to the…
Q: why are underground storage organs like onions, carrots, cassava, potatoes, etc high in carbs and…
A: Underground storage organs (USOs) are an important food source for many people around the world.…
Q: Based on the theory of island biogeography, how would you expect the species richness of birds on…
A: Theory of island biogeography The theory was given by MacArthur and Wilson in 1967. It studies the…
Q: ex. Locate any woodland or forest area close to your home. Create a 10 x 10 m quadrat once you've…
A: The goal of the study is to apply approaches to achieve the goal. During the process, information…
Q: Compare and contrast the steps of burong mustasa and kimchi preparation. explain the differences and…
A: Fermentation is a chemical process in which molecules such as glucose are broken down anaerobically.…
Q: a.) The conversion of the genital ridge into the bipotential gonad requires the Sf1, Wt1, and Lhx9…
A: Sex determination : There are certain genes which plays important role in sex determination. But…
Q: PCR is a new molecular technique used for a variety of purposes. Which of the following statements…
A: PCR (polymers chain reaction) is widely use in molecular biology as well as in the study of genetic…
Q: The following table shows the number of dogs for certain tail lengths in a population of dogs. Tail…
A: A trait is a characteristic features that is unique to particular individual . A trait can follow :-…
Q: Compare the reproductive organs of reptiles and birds. How are their reproductive patterns…
A: The skin of the reptiles is covered by scales or Bony plates. Birds body are supplied with feathers…
Q: 1. How does site specific recombination differ from homologous recombination? a. It requires a…
A: How does site specific recombination differ from homologous recombination Answer : a. It requires a…
Q: Question 13 Staphylococcus aureus toxin responsible for symptoms associated with food poisoning is…
A: Staphylococcus aureus is a Gram-positive round-shaped bacterium.
Q: Please answer asap and type your answer and do not copy from anywhere please In a study published in…
A: A keystone predator is one which "prevents a particular herbivorous species from eliminating…
Q: The Gulf of St. Lawrence is home to the beluga whalesThere once were thousands of belugas in this…
A: Bio accumulation: It is increase of contaminant concentration in aquatic organisms following uptake…
Q: How Alamanda Cathartica helps to prevent the lice on hair?
A: Alamanda Cathartica It is also called golden trumpet. It is a flowering plant which produce…
Q: Dominant trait: H (high metabolism) Recessive trait: h (normal metabolism) Possible Genotypes:…
A: Introduction "Genotype" refers to an organism's complete genetic information. The observed traits of…
Q: A population of wolves in a national park is known to be 150 individuals. As wildlife ecologist, you…
A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…
Q: This blood vessel carries blood away from the heart. O A. Artery O B. vein O C. venule O D.…
A: Blood circulate throughout your body with the help of certain vessels known as blood vessels. Thus…
Q: 11. A lecture hall of 1000 students conducts the same allele frequency simulation that we conducted…
A: Allele frequency: The allele frequency is a measure of genetic variation. It generally shows us…
Q: How do advantageous traits lead to evolution? Put the steps in the proper order. advantageous trait…
A: Variation. Organisms (within populations) exhibit individual variation in appearance and behavior.…
Q: What are morphogens? Explain how they influence tissue patterning during embryonic development.…
A: In this question we have to describe about role of morphogen during embryogenic development simple…
Q: Humans have employed biotechnology since ancient times to breed animals and improve their crops.…
A: Biotechnology means the branch of science which uses living organisms by combining natural science…
Q: Q1/Answer the following: 1. Describe the digestion of proteins by pancreatic enzymes? 2. Write the…
A: 1) Pancreatic proteases: Trypsin and chymotrypsin are endopeptidase type of enzymes. They…
Q: scuss all the importance of epithelium found in the digestive tract.
A: The digestive system is a collection of organs that aid in the digestion of food materials and the…
Q: are likely to be more reproductively isolated from one another than 20. a. A and C; B and C b. B and…
A: Shows the relationship between species. Organism closely related are grouped together. A and C are…
Q: thus, clonal expansion is The HIV attack the O Helper T cell / inhibited O Regulatory T cells /…
A: Answer :- Option (A) is correct. - Helper T cell / inhibited.
Q: Frog Late Blastula Self-Quiz #4 Frog Late Blastu 00 10
A: Self Quiz 3 :- 1). Blastocoel 2) Cortical pigment 3). Blastomere ( micromere nuclear) 4). Fragment…
Q: Which statement about correlation and causation is true? (a) A correlation is never a causation.…
A: Introduction: There is a link or pattern between the values of two variables when they are…
Q: Which of the following statements about mRNA is correct? a. Eukaryotic mRNA is generally…
A: Introduction:- Ribonucleic acid (RNA) is a nucleic acid that has structural similarities to DNA and…
Q: Muscle soreness following depletion of oxygen during strenuous exercise is due in part to a buildup…
A: Introduction :- Muscle soreness is a side effect of the stress that exercise places on muscles. It's…
Q: 6a. Complete this flowchart to describe an example of how different versions of a gene can result in…
A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…
Q: Which ecosystem has the least biodiversity?
A: Biodiversity where all the different kinds of life found in one area—the variety of animals, plants,…
Q: Why do you coat the elisa plate with albumin?
A: Introduction:- The acronym for enzyme-linked immunoassay is ELISA. Antibodies in the blood are…
Q: Choose the INCORRECT statement. O the occipital bone forms the posterior inferior portion of the…
A: Introduction :- The largest bone in the human skull is the mandible. It helps mastication and…
Q: "BIKINI BOTTOM GENETICS" Use the information for SpongeBob's traits to write the phenotype (physical…
A: A trait is a characteristic features that is unique to particular individual . In the question ,…
Q: Amari suspects they have a condition called metatarsalgia. This term is related to the term…
A: Introduction Metatarsalgia is a painful and inflammatory condition affecting the ball of your foot.…
Q: Q12: E is not the correct answer, what is the correct answer Flatworm parenchyma cells that are stem…
A: Flatworms Parenchyma is the tissue made up of cells and intercellular spaces that fills the interior…
Q: Label the parts of the avian skeleton
A: Aves Aves are the vertebrates group that includes birds. They evolved from reptiles. Some examples…
Q: Your friend is convinced his calico cat is male. He takes the cat to the vet. Sure enough the cat is…
A: Almost 99.9 % of all calico cats are females but this is because of genetics. The cats have 19…
Q: Where on your body đo microbes Iive? O A. On your skin O B. In your gut O C. In your mouth O D. All…
A: Microbes are small living beings present all over the place including soil, water and air. They are…
Q: Writing a Full Strand: 1. A. Original DNA: CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT…
A: DNA It is a nucleic acid which carries genetic information that gets passed from one generation to…
Q: Please answer asap You are caring for a patient with pulmonary (lung) Mycobacterium tuberculosis The…
A: Pathological presentation of infection caused by bacteria Mycobacterium tuberculosis .
Q: Which of the following is correct regarding galactosemia? O Type 1 galactosemia is also known as the…
A: Introduction :- Galactosemia is a condition that affects how the body processes galactose, a simple…
Q: Which embryonic germ layer lines the inner surface of the archenteron?
A: A germ layer is a collection of cells, formed during animal embryogenesis. Germ layers are only…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 2 images
- Refer to the succeeding diagram of two DNA samples (A, B) with the specific restriction enzyme(RE) recognition sites marked with arrows. A spontaneous mutation (insertion) occurred in DNAsample A and introduced an additional restriction site. 1. Design two (2) DNA probes to be used in RFLP analysis involving these two DNA samples.Draw/illustrate the region(s) in the DNA molecule which you will use as reference(homologous) sequences in the design of the probes, THAT -a. Will reveal RFLP polymorphism between the DNA samples after probedetection/visualization; andb. Will not reveal RFLP polymorphism between the DNA samplesGiven the DNA sequence of the restriction enzyme: gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGACCCAGAGATACTTCAGCTCTTTTGGGGACCTGTCGAGCCCAGCTGCCATTTGTGCCAACGCCAAGGTCCGTGCCCATGGCAAGAAGGTCCTGTCCGCCCTGGGAGCCGGCGCCAACCACCTGGATGACATCAAAGGCAACTTTGCTGATCTGAGCAAGCTTCACGCAGACACACTCCATGTGGACCCCAATAACTTCCTGCTCCTGGCAAACTGCCTGGTGATCGTCTTGGCCCGCAAGCTGGGAGCCGCCTTCAACCCTCAAGTCCATGCGGCCTGGGAGAAGTTCCTGGCCGTCTCCACCGCGGCTCTGTCCAGAAACTACCACTAGAGACTGGTCTTTGGGTTTAATTCTGTGAACGTCCCTGAGACAAATGATCTTTCAATGTGTAAACCTGTCATTACATCAATAAAGAGACATCTAACAAAAAAAAAAAAAAAAAAAAAAAAAA Identify two blunt-end cutters Identify two sticky-end cutters. For each, Provide the sequence of the Restriction enzyme, Highlight using a specific color where the DNA sequence where the restriction enzyme will cut the DNA Indicate the…Give the recognition sequences for each of the restriction enzymes (a) PagI, (b) AluI, (c) PstI, and (d) RcaI. Show the sequence in double-stranded DNA (dsDNA) format, indicate the cleavage position with a ^, and mention which types of ends are generated in each case (blunt or sticky; 5’ or 3’ overhang)? Recognition sequence for a)PagI cleaves DNA at the recognition sequence 5' ---T ^CATGA--- 3' b) AluI cleaves DNA at the recognition sequence 5' AG^CT 3' c) PstI cleaves DNA at the recog.
- The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given abovehe gel presented here shows the pattern of bands of fragments produced with several restriction enzymes. (a) From your analysis of the pattern of bands on the gel, draw the correct restriction map and explain your reasoning. (b) The highlighted bands (magenta) in the gel hybridized with a probe for the gene pep during a Southern blot. Where in the gel is the pep gene located?Given the following double-stranded fragment of DNA: 5'- ACTTGGCAGGCCTTCGATCC-3' 3'- TGAАССGTCСGGAAGCTAGG-5' A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold symmetry (typical for restriction enzymes) found in this fragment and catalyzes cleavage of this DNA on both strands between GG nucleotides within the recognition sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes). Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the ends.
- What, if any, are potential restriction enzyme recognition sequences in this DNA? (Only consider sequences of 6 bp or longer.) Using any of the sites which you identified in above, illustrate cleavage positions for that site which will result in a 5’ overhang or a 3’ overhang respectively.In a typical microbiology laboratory, reasons for no bands from a gel of a polymerase chain reaction may bedue to errors relating to omission of ingredients in the reaction mix and absence of the target sequence inthe template DNA. Based on (i) primer problem and (ii) purity/potential contamination of the target sequence, explain the reason for non-appereance on bands.1) The DNA fragment shown in Figure 1 is cleaved by the restriction enzyme EcoRI as indicated. The number in parenthesis shows the position of the cleavage site. The total length of the DNA fragment is 4000 bp. Small parts of the DNA sequence is known as shown. 5' ACCCTAGGTGTGACCGCGATCCGGCAGCATAAT 3' EcoRI (400) EcoRI (1300) EcoRI (3800) 3' CGCGAAATGCTTTAAGCGCTCTACGGGAGGG5' 3'AGCGTTAGAGTAGCCGGTAAAGGGTACGCGCCTTAA 5' Figure 1: DNA fragment with a total length of 4000 bp. The figure below depicts a gel on which marker DNA of known size has been run. Sketch the location of the bands that will appear, if the DNA fragment shown in Figure 1 is cleaved by EcoRI and afterwards run on the gel along with the marker DNA. 6000 5000 4000 3000 2000 1000 800 600 500 400 200
- Consider a partial restriction digestion, in which genomic DNA is exposed to a small, limiting amount ofa restriction enzyme for a very short period of time.a. Would the resultant fragments be longer or shorteror the same size as those produced by a completedigestion?The recognition sequence for the restriction enzyme TaqI is T↓CGA. Indicate the products of the reaction of TaqI with the DNA sequence shown.Complete the following problems. Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecular biology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequences by analyzing the fragments generated upon restriction digest, as in the example shown in Figure 1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjected the pMBBS plasmid to complete digestion by different combinations of three REs (EcoRI, BamHI, and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can glean from this gel, answer the questions that follow. EcoRI BamHI Xhol *The same total amount of DNA was loaded in each lane. 1. What is the total size of the pMBBS plasmid in bp? Answer: bp + DNA size ladder 2. How many cut sites on the PMBBS plasmid does each RE have? EcoRI: BamHI: Xhol: 3000 bp 2500 bp -2000 bp -1500 bp 1200 bp 1000 bp 900 bp 800 bp 700 bp 600 bp 500 bp 400 bp 300 bp 200 bp…