Q: If the length of E.coli DNA is 1.36 mm,can you calculate the number of base pairs in ECOLI?
A: DNA is the genetic material in E.coli. It has a circular DNA molecule 4.6 million base pairs in…
Q: Let’s say that a stretch of repeated AT issuccessfully sequenced. From what you know of the…
A: Sequence assembly involves the alignment and merging of fragments from a DNA (deoxyribonucleic acid)…
Q: The restriction enzyme Alu I cleaves at the sequence 5’-AGCT- 3' , and Not I cleaves at 5'…
A: Restriction enzymes or restriction endonucleases are endonuclease enzymes capable of recognizing a…
Q: Let’s assume the linker region of DNA averages 54 bp in length. How many molecules of H2A would you…
A: In eukaryotic cells, the basic structural unit of DNA packaging is known as the nucleosome. Its…
Q: If you were working on the Human Genome project and trying to distinguish genes from transposons,…
A: The gene is the sequence of nucleotides and is the functional unit of heredity. Genes contain…
Q: If you assume the average length of a DNA linker region is 50 bp,approximately how many nucleosomes…
A: The eukaryotic chromosome is made of half DNA and half proteins, from proteins, one half is the…
Q: How many different dna fragments would you expect to obtain if you cleaved human genomic dna with…
A: The cell is the fundamental unit of life. The nucleus part of the cell contains Deoxyribonucleic…
Q: Your PhD thesis advisor has given you the task of preparing a human genomic DNA library. 3a. How…
A: The length of the human genome is approximately 3.2 billion bases with genes of 20000-25000 protein…
Q: Calculate the expected number of times that a given 8-base-pair DNA site should be present in the E.…
A: A bacterial genomic DNA resides inside cells in a highly condensed and functionally organized form…
Q: In the actual experiment, the researchers used 149 sequences to buildtheir sequence logo, which is…
A: The sequence logo helps in predicting certain gene features. Gene features such as the ribosome…
Q: A researcher sequences the genome of a variety of bacterial and eukaryotic cells. She finds that the…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: How many of each base is found in the complete double-stranded molecule?
A: The concept is based on Chargaff's rule. It is given by Erwin Chargaff to calculate the amount of A,…
Q: Clearly, all humans have variations in their DNA sequences. How is it possible to sequence the human…
A: Answer- All the organism have certain amount of similarities in the DNA sequnece. In all the human…
Q: How many bits of information are stored in an 8-mer DNA sequence? In the E. coli genome? In the…
A: In DNA the digital data has been stored including the encoding and decoding of the DNA sequence. The…
Q: How many units (U) of EcoR1 did you use in the digestion? How much lambda DNA (in ugs) was digested…
A: DNA-cutting enzymes are restriction enzymes. Each enzyme recognises a single or a few target…
Q: Assuming human cells have on average 1000 mitochondria, what percentage by weight of the total…
A: The mitochondrial DNA (deoxyribonucleic acid) is 16.6 kilobase pair long that contains 37 genes. It…
Q: The sequence of the 15 bp fragment from the previous problem is repeated below: 5' TCTGAATTCCGTAGA…
A: DNA is a double-stranded molecule that is made of several nitrogen base pairs. The nitrogen base of…
Q: Calculate the length of the DNA of bacteriophage lambda that has 48502 base pairs.
A: Introduction: DNA stands for deoxyribonucleic acid and is a form of nucleic acid. Except for a few…
Q: ou have sequenced the genome of the bacterium Salmonella typhimurium and find a protein that is 100…
A: Natural selection is a theory that states that organisms evolved by changing their heritable traits…
Q: Approximately what percentage of the human genome isderived from transposable elements?a. 10%b.…
A: Introduction:- Transposable elements are DNA sequences that have the ability to travel or transfer…
Q: If you compare the frequency of the sixteen pos-sible dinucleotide sequences in the E. coli and…
A: Escherichia coli or E.coli is determined as a type of bacteria that resides in your intestines. It…
Q: Which of the following (A through E ) would you expect to find in a nucleotide chain constructed for…
A: Sanger sequencing is the method developed to sequence the short sequence of nucleotides base pair in…
Q: You have isolated a transposable element from the human genome and have determined its DNA…
A: A transposable element which is also known as jumping gene is a DNA sequence that plays a major role…
Q: In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…
A: When referring to DNA transcription, the coding strand is the DNA strand whose base sequence is…
Q: For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'
A: Polymerase chain reaction (PCR) is a technique to amplify the sequence of DNA. A large quantity of…
Q: If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is…
A: The genome is the entire DNA content (in base pair) of a haploid (n) cell. That means in case of a…
Q: On the basis of current knowledge, the protein-encoding regions account for only about 3% of the…
A: The Central Dogma of molecular biology states that: DNA makes RNA, which makes Proteins. However, a…
Q: Explain why genomic DNA libraries require more colonies than are comprised by a single genome…
A: Genes are the units of heredity that are transmitted through generations. Genes contain the genetic…
Q: If you compare the frequency of the sixteen possible dinucleotide sequences in the E. coli and human…
A: CG directly activates pDCs and B cells. The resultant immune response is characterized by the…
Q: In addition to correcting DNA mismatches, themismatch repair system functions to prevent…
A: Mutations are usually defined that they are supped to refer to changes or alterations that occur in…
Q: BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would…
A:
Q: The genetic đistance between DNA sequences 1 and 2 is what value?
A: Genetic distance : Distance between loci are determined by the frequency with which recombination…
Q: Arabidopsis thaliana has among the smallest genomes in higher plants, with a haploid genome size of…
A: Biotechnology is the use of our understanding of biological processes to develop useful applications…
Q: Assume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to…
A: Next-generation sequencing relies on the continuous sequencing of the genome parts and later…
Q: Suppose that a human genomic library is prepared by exhaustive digestion of human DNA with the EcoRI…
A: No, because most humans genes are much longer than 4kb.
Q: If the length of E. coli DNA is 1.36 mm, can you calculate the number of base pairs in E.coli?
A: DNA is the genetic material in E.coli. It has a circular DNA molecule 4.6 million base pairs in…
Q: The goal of many computer programs is to identify sequence elementswithin a long segment of DNA.…
A: A gene is a stretch of nucleotides present in the DNA molecule. It encodes information for the…
Q: Are the following base sequences sticky or not sticky? Each piece is written 5′ to 3′.(a) TTAGC and…
A: A base is nitrogen containing heterocyclic compound which, is found in DNA and RNA. There are…
Q: Suppose that a replicative DNA polymerase had its 3′ exonuclease site 1.5 nm from the polymerase…
A: A DNA polymerase is a member of a family of enzymes that catalyze the synthesis of DNA molecules…
Q: Given the Percentage Composition of One Nucleotide ina Genome, Can We Predict the Percentages of the…
A: Nucleotides are the chemical compounds that constitute the nucleic acids. The nucleic acids are of…
Q: Approximately how many Okazaki fragments are synthesized in thereplication of the human genome?
A: Okazaki fragments are short sequences of DNA nucleotides, which is synthesized during replication…
Q: Suppose that a nearly perfect 20- basepair inverted repeat is observed in a DNA sequence. Provide…
A: The copies of the DNA sequences that are organized in opposing orientation are called “inverted…
Q: Would you expect to find nuclear localization sequences(NLSs) in the proteins that make up…
A: A nuclear localization sequence is an amino acid sequence that aids in protein transport (import)…
Q: Explain symmetrical and rotational summetry types of palindrome sequences in DNA
A: Deoxyribonucleic acid (DNA) is formed of double helix strand that coil one above another. it is a…
Q: AAGTCAAGAAGAAGAAGAAGCC A. The nucleotide sequence above is a STR of how many repeats? B. What…
A: Short Tandem Repeats(STR) or microsatellites or simple sequence repeats(SSR) are short sequences of…
Q: Suppose you are a research assistant in a lab studying dna-binding proteins. you have been given the…
A: Amino acids are the organic compounds that acts as the building block of protein molecules. Proteins…
Q: In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…
A: Need to find the complementary strand for the given strand.
Would you be more likely to find single
polymorphisms (SNPs) in the protein-coding or in the
noncoding DNA of the human genome?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…https://drive.google.com/file/d/1fOtSuZ_NNdi7qRXHCkM6mtvwRS0pl8u6/view?usp=sharing Compute the [A + C]/[T or U] +G] ratios of the DNA and RNA models in Figure 1. Do you expect the same values for other DNA and RNA models that will be constructed for instance? Why?Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
- The human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?Your entire genome is about 6.4 billion basepairs long. If 41% of the human genome is either guanines or cytosines (know as the "GC" content), how many total adenines are in your genome? Keep in mind that the 6.4 billion basepairs refers to the length of the genome, but that DNA is double stranded.Let’s assume the linker region of DNA averages 54 bp in length. How many molecules of H2A would you expect to find in a DNA sample that is 46,000 bp in length?
- If you had the RNA sequence below: 5'UUUGGAG 3' and you were going to make a piece of DNA that would be a complement to it, what would the DNA sequence be? 5' 3' What 12-nucleotide primer would you use in the PCR technique when you want to amplify a gene whose end is as follows: 3' CGGCTCGACAAGGTG5' ? 5' 3'in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.How many binary sequences of length n contain at most five 1 digits? The genetic code specifies an amino acid through a sequence of three nucleotides. Each nucleotide can be of one of the four types T, A, C and G, beingrepetitions allowed. How many amino acids can be encoded in this way?And if there are n types. Compare
- Pinker mentions that only 1% of the human genome codes for proteins (the rest included introns, regulatory sequences, and repetitive DNA, some of it parasitic—we will talk about this later). Given that the human genome contains 3 x 109 base-pairs of DNA, there are about 20,000 human genes, and three base pairs code for each amino acid in a protein, how many amino acids are in the average human protein? [Hint: start with what fraction of base pairs in the human genome code for proteins.]Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA.