Answered: Write a program that prints the number…

Engineering

Computer Science

Write a program that prints the number of palindromes in this file ..../englishWords

C++ for Engineers and Scientists

4th Edition

ISBN:9781133187844

Author:Bronson, Gary J.

Publisher:Bronson, Gary J.

Chapter7: Arrays

Section7.5: Case Studies

Problem 7E: (File creation) Write a C++ program that creates an array containing the integer numbers 60, 40, 80,...

See similar textbooks

Similar questions

c# (File of Student Grades) Create a program that stores student grades in a text file. The file should contain the name, ID number, class taken and grade of every student. Allow the user to load a grade file and display its contents in a read-only TextBox.
What does the following python code do? f = open("sample.txt", "a") Choose all that apply. Select 3 correct answer(s) Question 15 options: opens a file called sample.txt for reading reads the file called sample.txt starting from the top writes "a" to the file called sample.txt opens a file called sample.txt for appending If the file called sample.txt exists, it writes at the bottom of the file closes a file called sample.txt if the file sample.txt exists, deletes everything in it if the file sample.txt does not exist, it creates the file and opens it for writing
Constraints: Use Python Don't use global variables Don't use external libraries (PIL and os are allowed) Start the program with a main function (def main():) Content: Ask the user for an input (an image file). If the file uploaded is not a jpeg/jpg file, print out "Try again!" and ask for an input once more. Continuously ask until a jpeg/jpg file is uploaded. Once a jpeg file is uploaded, create a function with the argument img_info and return a tuple with the image's dimensions in pixels (w, h) and the image data in a form of a list of tuples with RGB values. Print out the values/data collected. Thank you!
File Tools View Practical Quiz (Protected Vie PROTECTED VIEW Be careful-files from the Internet can contain viruses. Unless you need to edit, it's safer to stay in Protected View. Enable Editin Question 1 Write a python program using for loop which takes from user a choice number. If the choice is less than 10 and then print all the even numbers from 1 to 20 and if the choice is more than 10 print all the odd numbers from 6 to 30.
profile-image Time remaining: 00 : 09 : 42 Computer Science C++. Need help writing a program that plays the game of Hangman. The program should pick a word (which is either coded directly into the program or read from a text file) and display the following: Guess the word: XXXXXX Each X represents a letter. The user tries to guess the letters in the word. The appropriate response yes or no should be displayed after each guess. After each incorrect guess, display the diagram with another body part filled. After seven incorrect guesses, the user should be hanged. The display should look as follows: O /|\ | / \ After each guess, display all user guesses. If the user guesses the word correctly, display: " Congratulations!!! You guessed my word. Play again? yes/no " Please help in making this code and if possible to include steps to learn what most of the lines and functions do in order to understand it better. Thank you.
*python coding Driver’s License ExamThe local driver’s license office has asked you to create an application that grades the written portion of thedriver’s license exam. The exam has 20 multiple-choice questions. Hereare the correct answers:1. B 6. A 11. B 16. C2. D 7. B 12. C 17. C3. A 8. A 13. D 18. B4. A 9. C 14. A 19. D5. C 10. D 15. D 20. AYour program should store these correct answers in a list. The program should read thestudent’s answers for each of the 20 questions from a text file and store the answers inanother list. (Create your own text file to test the application.) After the student’s answershave been read from the file, the program should display a message indicating whether thestudent passed or failed the exam. (A student must correctly answer 15 of the 20 questionsto pass the exam.) It should then display the total number of correctly answered questions,the total number of incorrectly answered questions, and a list showing the question numbers of the incorrectly…
What does the following python code do? f = open("sample.txt", "w") Choose all that apply. Select 2 correct answer(s) Question 14 options: If the file called sample.txt exists, it writes at the bottom of the file writes "w" to the file called sample.txt closes a file called sample.txt opens a file called sample.txt for appending opens a file called sample.txt for reading reads the file called sample.txt starting from the top if the file sample.txt exists, deletes everything in it if the file sample.txt does not exist, it creates the file and opens it for writing
c++ program need help You are given a file containing many words. Read in all of the words from the file and insert each word into a searchable ADT. Give the user a looping menu allowing them to search for words in the word list. Searches must be be found in O(1) or constant time. Your code must time the search operations, and display the time to the user. For this assignment, you may use the provided word list or another word list with more than 150,000 words. Include this file with your submission. You must design and implement the following classes: Word: This class holds a single word as a string. Basic getters and setters are required. HashTable: This class represents the hash table for storing many words. Main: This is the driver class. The driver: Create a Hash Table Read in all of the words from a text file into the Hash Table Provide a looping menu for the user to perform searches. Time all searches and display the execution time to the user For each search: Prompt…
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
Programming Language: Python 1. Write a Python function that will take two integers from the user as arguments and returns the value of the larger one.
C Programming Write function checkHorizontal to count how many discs of the opposing player would be flipped, it should do the following a. Return type integer b. Parameter list i. int rowii. int col iii. char board[ROW][COL] iv. char playerCharc. If the square to the left or right is a space, stop checking d. If the square to the left or right is the same character as the player’s character, save that it was a flank, stop checking e. If the square to the left or right is not the same character as the player’s character, count the disc f. If the counted discs is greater than zero AND the player found their own character, return the counted discs, otherwise return ZERO Write function checkVertical to count how many discs of the opposing player would be flipped, it should do the following a. Return type integer b. Parameter list i. int rowii. int col iii. char board[ROW][COL] iv. char playerCharc. If the square above or below is a space, stop checking d. If the square above or below is…
Rest of code in image / This is a bad programming style since it is using goto. // This is an spagetti code and not working.// Use function to display menu, and display game rules,// Use different color for text display.// fix it so it works any way you like./*HANDLE screen = GetStdHandle(STD_OUTPUT_HANDLE); // Write 16 lines in 16 different colors. for (int color = 0; color < 16; color++) { SetConsoleTextAttribute (screen, color); cout << " Hello World!" << endl; Sleep(400); // Pause between lines to watch them appear } // Restore the normal text color) SetConsoleTextAttribute(screen, 7);*/#include <iostream>#include <windows.h>using namespace std;int main(){ //textbackground(WHITE); //textcolor(RED); system("cls"); char ch, a[20], ch2; int num = 100, rnum, guess, count, ch1, c = 0; cout << "**********************************************************"<<endl; cout << "*…