Write out a sequence of bases in mRNA (from 5' to 3') that would encode the peptide Ile-Tyr-Gly-Trp (from N-terminal to C-terminal).
Q: I still can't understand why we get about 24500 signals. Please let me know what formula I should…
A: The qPCR is generally useful to determine the actual value of PCR product present at provided cycle.…
Q: Why is it important that the alcohol used in the DNA extraction is kept cold? The solubility of any…
A: DNA can be extracted from any tissue or cell. There are four basic steps of DNA extraction. They…
Q: Mitochondrial DNA is (A) Circular double stranded (B) Circular single stranded (C) Linear double…
A: Mitochondrial DNA is a type of genetic material found in the mitochondria of eukaryotic cells. It is…
Q: Which of the following enzymes is unique to the liver? Beta-hydroxybutyrate dehydrogenase HMG-CoA…
A: Proteins that catalyse chemical reactions in living organisms are known as enzymes. They function as…
Q: Estimate the pl (isoelectric point) of a protein with the amino acid composition below. . Arg: 3…
A: The approximate pKa values for the amino acid residues are as follows: Arginine (Arg): pKa =…
Q: The buffer systems of blood, their role in maintenance of acid-base homeostasis
A: A buffer is a solution that can resist changes in pH when small quantities of acid or base are added…
Q: 24. Unsaturated fatty acid found in the cod liver oil and containing 5 double bonds is (A)…
A: The answer explains that the unsaturated fatty acid found in cod liver oil that contains 5 double…
Q: Elimination of skatole and indole - tryptophan conversion products.
A: Skatole and indole are products of bacterial metabolism of tryptophan in the intestine. These…
Q: 8) Adrenergic receptors are the a. G-protein coupled receptor b. Ligand-gated ion channel c.…
A: Receptors are specialized proteins found on the surface of cells or within cells that are…
Q: Please draw all of the structures of the intermediates and names of all reactants, intermediates and…
A: Glycolysis is the metabolic pathway that stepwise oxidises glucose to pyruvate to produce ATP and…
Q: The limit for G-200 beads is 5000-600,000. When you pass two proteins- Protein A (75, 000), Protein…
A: The concept here relates to the use of gel filtration chromatography, which is a type of size…
Q: All the following are sulphur containing amino acids found in proteins except (A) Cysteine (B)…
A: The correct answer is (D) Threonine, which is not a sulphur-containing amino acid found in proteins.…
Q: Calculate the standard free energy change (AG) for the transfer of electrons from succinate to…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: Which of the following inactivates the 605 subunit of eukaryotic ribosomes? a) Ricin b)…
A: Protein synthesis is a fundamental process for all living organisms, and its inhibition can have…
Q: You got a job as an adjunct instructor at a community college and want to make 300 ml of a 3%…
A: Introduction. Carbohydrate is one of the biomolecules found in living organism. Maltose is a…
Q: 8. The true statement about solutions of amino acids at physiological pH is (A) All amino acids…
A: Amino acids are the basic building blocks of proteins and are essential for various biological…
Q: Which of the following catalyzes reactions that incorporate nitrogen derived from glutamine? a)…
A: The enzyme that catalyzes reactions that incorporate nitrogen derived from glutamine is b) Glutamine…
Q: Which of the following best describes the peptide backbone in a β-sheet? Group of answer choices…
A: A β-sheet is a common secondary structure motif found in proteins, consisting of multiple…
Q: Give an ac ctivity.
A: Enzymes are important biological catalysts that facilitate chemical reactions in living organisms.…
Q: A researcher is following an immunohistochemistry protocol. Before blocking the tissue section, the…
A: Immunohistochemistry is a method which can be used to detect antigens present in a tissue sample by…
Q: Please show the energetical math for why it is not a violation of the first law, such as by…
A: In the simplest form, this law states that energy can neither be created nor destroyed but can…
Q: Consider a liver cell carrying out the oxidation of glucose and fatty acids under aerobic…
A: ATP is the energy currency of the cell and is primarily produced by ATP synthase present in the…
Q: Based on the given figure, answer the following questions CH₂OH OH H H OH H H CH₂OH O Glucose H OH H…
A: Introduction Polysaccharide is one of the important carbohydrate present in plant cell wall.…
Q: 21. Dietary Sources, RDA factors affecting absorption, functions and deficiency manifestations of…
A: In this answer, we will discuss the important mineral calcium, which plays a crucial role in…
Q: Looking at the structure of alpha linolenic acid, how many rounds of beta oxidation will occur to…
A: Introduction: In biochemistry and metabolism, beta-oxidation is the catabolic process by which fatty…
Q: During pregnancy a special fetal hemoglobin was made with the following characteristics: It…
A: Hemoglobin is a blood protein which is resonsible for transport of oxygen and other gases in the…
Q: Calvin-Benson Cycle EC Ribulose-1,5-bisphosphate carboxylase 4.1.1.39 oxygenase Enzyme…
A: The Calvin cycle is a process done by photosynthetic plants for carbon dioxide fixation. Here,…
Q: 4. Oxidation of which substance in the body yields the most calories (A) Glucose (B) Glycogen (C)…
A: The human body requires energy to carry out all its vital functions, from basic cellular processes…
Q: 9) Epinephrine is synthesized from a. Tyrosine b. Tryptophan c. Glutamine d. Asparagine e. Glycine
A: Epinephrine, also known as adrenaline, is a hormone and neurotransmitter produced by the adrenal…
Q: List three major effects propranolol will have on the human body.
A: The medicine propranolol is a member of the class of medications known as beta-adrenergic blockers,…
Q: How does RNA acquire the ability to function as a ribozyme? If DNA enzymes are so important, why…
A: A ribozyme is an RNA molecule that has the ability to catalyze specific biochemical reactions,…
Q: 2. Vitamin A or retinal is a (A) Steroid (B) Polyisoprenoid compound containing a cyclohexenyl ring…
A: The question asked about the structure of Vitamin A or retinal and presented four options: (A)…
Q: 3. Choice is good . Glycogen is not as reduced as fatty acids are and consequently not as energy…
A: Animals store energy as glycogen because it is a rapid and easy to mobilize source of energy,…
Q: Write a short note on the biologically important peptides.
A: Introduction: The below answer provides an explanation of the various factors that can affect enzyme…
Q: Assume that mitochondria contain 0.35 Molar KCL and 0.012 Molar NaCl. Calculate the grams per liter,…
A: Mitochondria has: Molarity of KCl = 0.35 M Molarity of NaCl = 0.012 M It is required to calculate…
Q: what are the formal chemical names for sucrose,lactose and maltose?
A: Sucrose, lactose, and maltose are all disaccharides, which are composed of two monosaccharide units…
Q: 1. The initial rate of an enzymatic reaction was determined at different substrate concentrations.…
A: Enzyme kinetics is the study of the rate at which enzymes convert substrates into products, as well…
Q: A violation of the First Law? The complete combustion of glucose to CO 2 and H 2 O yields 30 ATP, as…
A: The First Law of Thermodynamics, which states that energy cannot be created or destroyed, only…
Q: Which one of the following is the source of electrons in photosynthesis? c) Carbohydrates d) CO2 a)…
A: Photosynthesis is the process by which green plants, algae, and some bacteria convert light energy…
Q: What is the chemical basis of rancidity? How can it be prevented?
A: Introduction: The given answer explains the chemical basis of rancidity and the ways to prevent it.…
Q: or question 1, oleic acid should be counted for palm too. and 74% is unsaturated fat for coconut.
A: Fatty acids are carboxylic acids with hydrocarbon chains that contain anywhere between 4 to 36…
Q: 9. In the graph below what is the K₁ for the agonist? Occupancy 1.0- 0.75- 0.5- 0.25- 0 -10 9 8 7 6…
A: KA is the equilibrium dissociation constant of the interaction of an agonist (A) with its receptor…
Q: The individual hemoglobin subunits and myoglobin share similar ________ structure but have rather…
A: Heme proteins that act as oxygen binding proteins are haemoglobin and myoglobin. The fundamental…
Q: After plasmid isolation, you take 0.5 uL of the sample and mix it with 1 uL of TE buffer. The…
A:
Q: 5. What is the strength of a medicine when mixed with 40 mg in 100 ml of total solution?
A: The dosage of a medicine is typically calculated based on the patient’s weight and the prescribed…
Q: Glycosaminoglycans have the following characteristics except— Each disaccharide unit contains a…
A: Glycosaminoglycans: These are simply called as GAGs which are found in mammalian tissues. They are…
Q: How are the ER and Golgi involved in membrane creation? (Think about lipid synthesis and…
A: Introduction: The above answer provides an explanation of how the endoplasmic reticulum (ER) and…
Q: 9. Classify acid-base disorders and explain them along with compensatory mechanisms.
A: The pH of the blood is an essential factor for the proper functioning of the human body. Any…
Q: 21. The aldose sugar is (A) Glycerose (B) Ribulose (C) Erythrulose (D) Dihydoxyacetone
A: Here provided explanations for each of the answer options in regards to which one is an aldose…
Q: 3. Explain about the Enzymes for assessment of Liver Function.
A: Liver function tests are laboratory tests used to evaluate the overall health and function of the…
Give detailed solution with explanation need (don't use Ai) give answer asap
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA that would translate the synthesis of the following pentapeptide:Arg · Ile · Cys · Tyr · ValGiven the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA that would translate the synthesis of the following pentapeptide:Arg · Ile · Cys · Tyr · Va
- What amino acid sequence does the following mRNA nucleotides sequence specify? 5'- AUGGCCAGCUGU -3' Express the sequence of amino axis's using the three-abbreviations, separate hyphens (e.g., Met-Ser-Thr-Lys-Gly).A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
- Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)Using the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAU
- (b) Hemoglobin is made of B-globin subunits. The first few mRNA nucleotides for B- globin are given by: (1) (iii) (iv) Write down the DNA sequence that has led to this mRNA and indicate the sense and non-sense strands and the polarity. CE Derive the polypeptide for the sequence using the table of the genetic code (Table Q1 below) and indicate the polarity of the polypeptide chain. First Position (5' end) U A single point mutation in mRNA sequence can cause sickle cell anemia by changing the amino acid Glu to Val. For the given mRNA, indicate the point mutations for the first Glu in the polypeptide sequence that can cause this disease. 5'-AUGGUCCACCUGACUCCUGAGGAGAAG...UGA-3' C The polypeptide of B-globin contains the amino acid Leu. Write down all the anticodons of the tRNA molecules that can potentially code for Val. Indicate the polarity of the anti-codon. A G Table 1. The Codons of the Genetic Code Second Position U Phe Phe Leu Leu Leu Leu Leu Leu Ile Ile Ile Met-Start Val Val Val…The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.