Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of DNA with the following base sequences: 5'CGGAC3'
Q: Give the base sequence of the complementary DNA strand of the DNA chain with the following base…
A: DNA is a macromolecule composed of individual subunits known as nucleotides. Each nucleotide…
Q: Write the sequence of the complementary DNA strand that pairs with each of the following DNA base…
A: The deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains. It coils around…
Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and…
A: DNA molecules store genetic material and two primary processes are necessary in order for DNA to…
Q: If the sequence of bases in one strand of DNA is 5′ TAGCCT 3′,then the sequence of bases in the…
A: Answer is c.) 3'ATCGGA5'.
Q: Write the complementary DNA strand for the following DNA base sequence: 5' СТСААG 3' 3' 5'
A: Central dogma consists of replication, transcription and translation. Replication is the synthesis…
Q: Give the corresponding strand of the DNA having the sequence of: a. 5’…
A: DNA(deoxyribonucleic acid) is the heredity material for most living organisms. It is composed of…
Q: Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT
A: In DNA replication, the rule of complementarity is as follows- 1. Adenine (A) and Thymine (T) are…
Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…
A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…
Q: Draw a short segment of a single polynucleotide strand, including at least three nucleotides.…
A: A nucleotide has three components namely,(a) A nitrogenous base.(b) A pentose sugar (ribose in case…
Q: Two base pairs of double-stranded DNA are shown in the figure. Use your knowledge of base structure,…
A: DNA In DNA there are 4 bases Adenine, Thymine, guanine and cytosine. Adenine binds with Thymine…
Q: Match the following terms with their correct definition. The structure of double-standed DNA Hold…
A: Answer. The monomeric units of nucleic acids are called nucleotides. Nucleic acids, therefore, are…
Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…
A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…
Q: Write the sequence of the complementary strand of the following portion of a DNA molecule: 5…
A: DNA (Deoxyribonucleic acid) is the primary genetic material for most life forms. However, certain…
Q: Given the following sequence for one strand of a double-stranded oligonucleotide:…
A: Nucleic acids are of two types: RNA and DNA RNA It is referred to as ribonucleic acid. It is…
Q: Which of the following would be the correct complementary sequence to this strand of DNA: 5 ATTCGATC…
A: Question- Which of the following would be the correct complementary sequence to the strand of DNA…
Q: Give the complimentary DNA strand for the following: ACG TAG CTA GTC AGT CGT AGC Give the RNA…
A: NOTE:- Since you have posted a question with multiple sub-parts, we will solve the first three…
Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction…
A: ••Complimentary strand of DNA is made by by process of Replication Replication is process in which…
Q: Draw the following strands of DNA 5’ C-A-T 3’ as well as the complementary base pairing strand…
A: Two strands of DNA twist around one another to form a double helix DNA and both are in anti-parallel…
Q: A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the…
A: Ribonucleic acid (RNA) is a polymer of ribonucleotides that participate in diverse biological roles…
Q: Which structural feature of DNA is shown in the figure marked as "X"? (A
A: Introduction A DNA molecule consists of two strands that wind around each other like a twisted…
Q: Match the label on the left with the correct structure number in the DNA molecule in the image…
A: The given structure is of a alpha helix DNA. The DNA is composed of nucleotides. Nucleotide - The…
Q: Of the following DNA sequences which would you expect to have the highest melting temperature in its…
A: Melting temperature is defined as the temperature at which a double-stranded DNA molecule will break…
Q: Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base…
A: A nucleotide is formed by nitrogenous base, sugar and phosphate. Commonly found bases in DNA are:…
Q: Match each DNA component to its corresponding point of attachment. 1. carbon 3' 2. carbon 5' 3.…
A: Deoxyribonucleotide (DNA) is a molecule containing all the genetic information needed to make each…
Q: Which of the following statements are true about double-stranded DNA? Write TRUE or FALSE 1. A+G=C+T…
A: DNA is a double stranded molecule with complementary base pairing. Complementary base pairing occurs…
Q: Which one of the three parts to a nucleotide is used to determine the 5' to 3' direction of a DNA…
A: A consequence of the structure of nucleotides is that a polynucleotide chain has directionality –…
Q: One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3'. Write the sequence of its complementary…
A: A DNA helix is an antiparallel helix that is wound on each other. It consists of two complementary…
Q: Fill in the palindromic sequence of the given DNA strand containing six bases. 5' GACGTC 3' 3' _ _…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Write the complementary sequence for the following DNA sequence, in order from 3' to 5':…
A: Deoxyribonucleic acid (DNA) is the hereditary unit of life, which carries the genetic information in…
Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…
A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…
Q: Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’…
A: Nucleus is main controller of the cell which carries genetic instructions . It contain Chromosome…
Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…
A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the…
A: Deoxyribonucleic acid (DNA) is a molecule with two chains of polynucleotides that wrap around one…
Q: Write the sequence of the DNA strand complementary to the following strand:…
A: DNA or Deoxyribonucleic acid is the double helical structure, present in each and every cell of all…
Q: If the sequence of the 5'-3' strand is AATGCTAC, then the complementary sequence has the following…
A: DNA is the double stranded structure. Both strand is antiparallel to each other, direction of one…
Q: Provide the sequence of the primer that is complementary to the DNA in each of the following…
A: Site A: 5' CTATGCGCTA 3'
Q: (a) Provide the sequence of the DNA complementary to the following strand (please write it in the 3'…
A: Complementary DNA Complementary DNA (cDNA) could be a DNA copy of a mRNA (mRNA) molecule created by…
Q: Tabulate the differences of the various DNA conformations in terms of orientation, rise per base…
A: The DNA duples model proposed by Watson and Crick was right handed spiral known as B-DNA. apart from…
Q: Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT…
A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus controls…
Q: Look at the image of the the dinucleotide (two nucleotides joined togethr in a single strand). Base…
A: Nucleotide are the basic building blocks of DNA. A nucleotide consists of a sugar, nitrogenous base…
Q: Type the matching bases below in each DNA sequences. A T T C G A C G T C
A: DNA sequence composed of a row of chemical building blocks - called "bases". There are four types of…
Q: Give the DNA compliment to the following DNA strand. GAA CTT a b. GAA CUU BRB
A:
Q: Write the base sequence in a complementary DNA segment if each original segment has the following…
A: The cell is the basic primary unit of life for all living organisms. Inside this, the nucleus is the…
Q: Indicate the correct base order for the complementary DNA strand by placing the correct label in…
A: A DNA strand is formed of nitrogenous bases also called nucleobases. There are 4 nucleobases viz.…
Q: Draw the full structure of the DNA strand: 5'-ATG-3' To the above strand, draw the complementary…
A: Nucleic acid are the macromolecules which are of two types :- DNA and RNA DNA is deoxyribonucleic…
Q: Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and…
A: The complementary DNA sequence of DNA coding strand ATGATTATCCTATAG is TACTAATAGGATATC.
Q: If the length of E.coli DNA is 1.36 mm, calculate the number of base pairs it contains
A: Introduction: DNA (deoxyribonucleic acid) is the molecule that transmits genetic information for an…
Q: What is the nucleotide sequence of the DNA strand that is complementary to 5'-GGCGCAACTGTCACAA-3'
A: A nucleic acid sequence is a set of five letters that indicates the order of nucleotides in a DNA or…
Q: Write the sequence of a strand of DNA replicated using each of the following base sequences as a…
A: DNA replication is a process in which a template strand of DNA is replicated by forming a new strand…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helixGiven the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?
- Write the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACATGive the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.
- In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called the:For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.
- Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid.This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.The complementary sequence for the strand given below is 5' AUU CCU CCC AAU AUG 3' O 5 CAUAUUGGGAGGAAU 3 O 5' UAAGGAGGGUUAUAC3' O 3' GUAUAACCCUCCUUA 5' O3' AUU CCU CCC AAU AUG 5'