1. Below are the genotypes for two individuals. Loci A and B are two different microsatellites. The numbers tell us which allele of the microsatellite they carry. Locus A 8/9 Locus A 8/8 5/7 3/5 Person 1 Locus B Person 2 Locus B Draw the chromosome, labelled with alleles for Person 1 and 2. Assume Locus A and B are located close together on the same chromosome.
Q: There was a mix of virus and E.coli DNA thats isolated and separated . One DNA sample had a base…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: 1. An image of a DNA profile is shown below. The size marker fragments are not shown, but the size…
A: STR stands for Short Tandem Repeat . This analysis is a common molecular biology method. It is used…
Q: The following map shows a test crossing experiment that was conducted to find out the relative order…
A: Double cross over would happen if two cross over takes place at the same moment. That means only the…
Q: In Figure 17-26, the bottom panel shows that genes B andC are oriented in a different direction…
A: Inversion has many effects on genes either it has no effect or disrupts the gene function. This…
Q: Examine the “RNA-Seq Coverage” and the “FlyBase Genes” tracks in the Genome Browser from left to…
A: Introduction: RNA is a single-stranded molecule in many of its biological roles and consists of a…
Q: The drawing below depicts a restriction map of a segment of a human chromosome. The cut sites shown…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. If you need help with other sub…
Q: A research team interested in mapping human genes discovered a new restriction length polymorphism…
A: Restriction fragment length polymorphisms (RFLPs) uses the variations in DNA sequences of genome…
Q: The first genetic test developed for this disease took advantage of a large family of over 2,000…
A: Huntington’s disease is a neurodegenerative disease. The symptoms of the disease start mildly such…
Q: Give 1 example of diseases arising from each of the following mutations and explain each. Point…
A: mutations are any alternations in genetic sequence in the dna . mutations cause change in the…
Q: When you collect your cheek cells and prepare the DNA, is it really a problem that bacteria and food…
A: Answer: Cheek cells are the cells in buccal cavity whose DNA can be studied and it is easily…
Q: 5. Patients with palmoplantar keratoderma (PPK) have yellowish thickening of the skin on their hands…
A: Introduction :- A pedigree is a genetic representation of the inheritance of a trait or disease…
Q: please only answer parts d and e and f
A: To figure out which baby goes to each set of parents it is decided to perform PCR as there are three…
Q: 4) If 20% of a culture of human cells have a DNA content somewhere between 1&2xs (S-phase= 8 hours)…
A: S phase is synthesis phase during which DNA is replicated when the cell is undergoing mitosis.
Q: Which of the following statements is correct? a. If a deletion and a duplication are the same size,…
A: Deletions occur when a chromosome break and some genetic material is lost. Deletions can be large or…
Q: (a) duplicated genes that have lost their function orthologous genes paralogous genes…
A: Genes are the basic unit of heredity. They are made up of DNA. The DNA sequence in genes is encoded…
Q: 4. The image below is based on the Meselson Stahl experiment where bacteria are grown in 15N and…
A: The Meselson-Stahl experiment showed that DNA replication is a semiconservative process. In this…
Q: 2. Below is data from an HFR time of entry gene mapping experiment. Create a map of the chromosome…
A: Time of entry mapping is a technique used to map out genes in E coli hrF strain ,interrupted mating…
Q: . Which of the following statements about STRs is correct? 1. They are highly polymorphic. 2.They…
A: STR stands for Short Tandem Repeat, it is a region of a DNA molecules contains short segment that…
Q: 1. Using the diagram below, fill in the following Table to give the names of the genes that are…
A: Genetic recombination occur during meiosis in prophase during the pachytene and thus formation of…
Q: Based on the text for roaches: 1. Compare the genetic relationship of the parent pest and its…
A: Any insects are threats because they infest human homes. Since they are usually found in waste…
Q: What characteristics of VNTR and STR make them useful for DNA fingerprinting?
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: 3A.Below are a few (of the many) possible errors that could adversely affect PCR or analysis of PCR…
A: A PCR result can be disappointing in many ways. If DNA and primer concentration are reversed, the…
Q: 1.What is the genetic distance between C and D genes? a.22 CM b 2.2 cm c.220 kDa d.22 Mb…
A: During the meiosis stage of sexual reproduction, DNA sequences that are near together under a…
Q: The presence (+) or absence (−) of six sequences in each of five bacterial artificial chromosome…
A: Bacteria are a prokaryotic microbe which have undefined nucleus and nuclear membrane. Bacterial…
Q: look at the result of the following genotyping of three different members of the same family the to…
A: Asked : Meaning of the dna products of different lengths obtained
Q: When constructing a recombinant DNA molecule, a marker gene is used to: a. give the organism a…
A: Answer :- b. Identify whether the transformed organism contains the recombinant DNA
Q: . A haplotype is a specific set of SNPs and other genetic variants observed on a single chromosome…
A: DNA can be defined as the type of nucleic acid which is made from deoxyribose sugar along with four…
Q: Based on the text for mosquitoes: 1. Compare the genetic relationship of the parent pest and its…
A: 1. Compare the genetic relationship of the parent pest and its offspring. Use the word: genetically…
Q: Explain the V(D)J recombination of multiple gene elements
A: RECOMBINATION It is the process in which pieces of DNA are broken physically, exchanged, and then…
Q: 1. Which of these methods will allow cell counting and segregation? a. Flow Cytometry b. Western…
A: Introduction :- Bio-physical techniques or methods are combination of biological and physical…
Q: _1. Bacterial proteins that have the ability to cut both strands of the DNA molecule at certain…
A: DNA and RNA are the two main forms of nucleic acids. Nucleotides, which have a five-carbon sugar…
Q: Using the conventions of Figure 4-15, draw parents andprogeny classes from a crossP M′′′/p M′ × p…
A: Polymerase chain reaction (PCR) is a process frequently used to swiftly create millions to billions…
Q: The picture below depicts an aberration in the process of genetic coding. Which of the following…
A: DNA replication is the process by which a new DNA is synthesized by using a parental DNA molecule.…
Q: 3. Predict the number of DNA fragments and their sizes if Lambda phage DNA were incubated and…
A: Restriction enzymes are one of the important tools of recombinant DNA technology. The name…
Q: A second site mutation within a single gene that reverts the gene back to its wild type phenotype…
A: a second site mutation on a single gene that reverts the gene back indicates reversion within an…
Q: 1) you have a locus in your PCR reaction that is a DNA squence is on the fifth chromosome, is a…
A: Gel electrophoresis is a common laboratory method used for the separation of DNA, RNA, or proteins…
Q: Microsatellites are currently exploited as markers for paternity testing. A sample paternity test is…
A: The human genome possesses numerous small noncoding but inheritable sequences of bases that are…
Q: Deletions in bacterial chromosomes give the following data: Region of deletion Al Gene A activity…
A: The gene is located in A3 region. Because deletion of the A3 region leads to the least activity of…
Q: (AKS 8a2, DOK 1) Analyzing DNA with a DNA fingerprint developed by gel electrophoresis allows…
A: DNA fingerprint is a process that allows identifying paternity by compared among several…
Q: What is a contig?
A: Chromosomes are long thread-like structures that carry coded genetic information in the form of DNA.…
Q: If hybrid DNA is allowed to replicate for one generation in medium containing N15 and for second…
A: DNA belongs to the family of biomacromolecules known as nucleic acids that are formed of…
Q: In the Holliday model for homologous recombination shown, the resolution steps…
A: Deoxyribonucleic acid (DNA) is the hereditary material that undergoes replication which is vital for…
Q: Which of the following is not a way in which genetic recombination occurs bacteria. Group of answer…
A: Prokaryotes are the single celled organisms (unicellular) and are the simplest form, which do not…
Q: 1) Using the diagram below, sketch in the pattern of bands you would expect to see after digesting…
A: TAS2R38 is a taste receptor gene present in the 7th chromosome of the genome. The length of a gene…
Q: There are three babies (Baby A, Baby B and Baby C) in a maternity ward, and three sets of confused…
A: Dear student, as per our honour code we are authorized to answer one question at a time with maximum…
Q: Genes D, E and F are located on the same chromosome. From a three-point testcross mapping…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Why would multi-gene families complicate things in terms of being sure of which member of the family…
A: It is the gene which ultimately determines the phenotype. Thus there is a direct relationship…
Q: The following diagram shows the genetic map of an individual in the region of a gene that has a…
A: There are fifty percent chances of child getting marfan syndrome because marfan syndrome is caused…
Q: Make simple steps to extract isolating DNA from strawberries and yeast.
A: Answer
Q: 1. How does site specific recombination differ from homologous recombination? a. It requires a…
A: How does site specific recombination differ from homologous recombination Answer : a. It requires a…
Question in photo
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- . E. coli chromosomes in which every nitrogen atom is labeled (that is, every nitrogen atom is the heavy isotope15N instead of the normal isotope 14N) are allowed to replicate in an environment in which all the nitrogen is 14N.Using a solid line to represent a heavy polynucleotidechain and a dashed line for a light chain, sketch each ofthe following descriptions:a. The heavy parental chromosome and the productsof the first replication after transfer to a 14N medium,assuming that the chromosome is one DNA doublehelix and that replication is semiconservative.b. Repeat part a, but now assume that replication isconservative.c. If the daughter chromosomes from the first divisionin 14N are spun in a cesium chloride density gradientand a single band is obtained, which of the possibilitiesin parts a and b can be ruled out? Reconsider theMeselson and Stahl experiment: What does it prove?2c) If the whole potoroo genome is 4.2 x 10' bp, and the highlyrepetitive DNA in the potoroo genome is composed entirely ofcopies of the sequence 5'AAGACT' and its complement, howmany copies of this sequence are present in the potoroogenome?(i) For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAAATTGT TA T CCGC T CA CA AT T C CACA CA A CATA CGAGC CGGAAG CA TA A 110 120 130 140 150 160 (ii) An allele of a gene has the following change in it's sequence ATG GTG CÁC CTG ACT CCT GTG GAG AAG TCT compared to the wild type ATG GTG CAC CTG ACT CT GAG GAG AAG TCT With reference to the sequence; there is a codon, resulting in a change from is a mutation in the to which mutation.
- Please consider the figure below, parts A and B. A В Gene B Gene C Gene B Normal Gene A Chromosome 12 Normal Chromosome 1 Please consider figure A. a. Do these chromosomes come from a dividing or non-dividing cell? Give a reason for your answer. b. How many molecules of double stranded DNA will be present at anaphase I of a cell from this organism? Please consider figure B. A potentially carcinogenic mutation occurred on one of the chromosomes. The gene affected by the mutation codes for a protein involved in the repair of DNA damage. c. What is the correct term used to describe this chromosomal mutation? d. In terms of the development of cancer, is this a dominant or recessive mutation? e. What is the consequence of this mutation if it occurs during meiosis and is inherited by the offspring? Explain your answer in terms of the function of the protein.The results of a paternity test are shown in the table below. Numbers indicate the number of short tandem repeats for loci tested. Whos the daddy? How sure are you?The completely synthetic yeast chromosome Syn IIIcontains a loxP site in the 3′ UTR of every gene thatis potentially nonessential to yeast survival. As youwill recall from Chapter 6, loxP sites are targets ofsite-specific recombination. The researchers who constructed Syn III included these loxP sites as a way to“scramble” the chromosome, meaning that parts ofthe chromosome could easily be deleted or rearranged.The goal of these investigations is to drive the evolution of Syn III so as to define a minimal genome thatcan support the life of this organism. Outline the experiment the researchers would do to scramble Syn IIIin order to define a minimal genome.
- When the interrupted mating technique was used withfive different strains of Hfr bacteria, the following orders ofgene entry and recombination were observed. On the basisof these data, draw a map of the bacterial chromosome.Do the data support the concept of circularity?HfrStrain Order1 T C H R O2 H R O M B3 M O R H C4 M B A K T5 C T K A BSummary table of data for one yeast DNA microarray. Shows 14 of the 6,200 genes on the full microarray. Also contained in the data is the location of each spot on the microarray. Block Column Row Red 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Gene Name tubl tub2 sec1 sec2 sec3 act1 act2 fus 1 idp2 idp1 idh1 idh2 erd1 erd2 2,345 3,589 4,109 1,500 1,246 1,937 2,561 2,962 3,585 2,796 2,170 1,896 1,023 1,698 Green 2,467 2,158 1,469 3,589 1,258 2,104 1,562 3,012 1,209 1,005 4,245 2,996 3,354 2,896 Red: Green Ratio 0.95 1.66 2.80 0.42 0.99 0.92 1.64 0.98 2.97 2.78 0.51 0.63 0.31 0.59 Induced or Repressed? In the table above, write down if the gene is induced, repressed, or equally expressed.A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’
- A DNA fragment of interest is inserted in the BamHI site of plasmid PBR322.The recombinants will be: HindIII ECORI EcoRV BamHI 439 0 29 is 4000 375 Sall PstI, 651 tet amp 1000 PBR322 4361 bp 3000 ori 2000 2295 Ndel A. Resistant to amp an tet B. None of the other options, Xgal is required for selection O C. xensitive to amp, resistant to tet None of the other options, Xgal is required for selection O D. Sensitive to tet, resistant amp O E. Sensitive to amp and tetFig 3.16 EcoRI SacI KpnI |ampR Aval Xmal Smal lacZ BamHI Xbal SalI Accl HincII PstI Sphl HindIII Bam H1 Bam H1 Bam H1 1 2 3 4 The ends of the double-stranded DNA fragment above are blunt ends. The directionality of genes contained within the fragment is from left to right (arrow). After digestion by BamH1, which fragment can be inserted into the vector cut with BamH1 and Sma 1 maintaining the same directionality as the lacz promoter (green segment with arrow on vector)? 3 O 4 O1 232)An origin of replication is given below. Sequences of selected parental strand regions are given. The directionality of the bottom parental strand is indicated. Use the diagram to answer the corresponding questions. #2 *1 CTAAGCA ATCGAGG XXXXX XXXX 3' ICTAGTT 5' ge exon #3 a.) On the diagram, label the 5' and 3' end of the top strand of parental DNA b Draw arrows to indicate direction of DNA synthesis for each of the 4 daughter strands. e) For each daughter strand, specify if synthesis is continuous or discontinuous. d) On your diagram, label the 5' and 3' ends of the newly synthesized daughter strands e.) Which parental strands are the template for leading strand synthesis? (# 1- 4) Strand # Strand # f.) Which parental strands are the template for lagging strand synthesis? (# 1- 4) Strand # Strand # g.) What is the specific sequence of the primer required to start DNA replication ior strands 1 and 3? Assume the primer will bind to the location where the base sequence is given on…