B-oxidation deals with only saturated fatty acids, but many fatty acids in natural lipids are unsaturated, meaning they contain one or more double bonds. Considering the fatty acid below, calculate the energy yield of its complete oxidation OH Express your answer using three significant figures.
Q: Question 4
A: The objective of the question is to identify the origin of spindle growth during cell division.
Q: Which property increases in magnitude during the steps of sequential purification of an enzyme?…
A: Enzyme purification is defined as a process by which enzymes are separated and isolated from other…
Q: topic: enzymes In which organs or tissues are they usually present in the human body? Tabulate your…
A: Different Organs and Enzymes InvolvedOrgan/TissueEnzymes PresentFunctionsStomachPepsin, Gastric…
Q: Question 27 These are all examples of polysaccharides except_ a. starch b. glucose c. cellulose d.…
A: Starch: Starch is a polysaccharide that serves as a storage form of energy in plants. It consists of…
Q: 23. Calculate the free energy of hydrolysis ATP in a rat liver cell in which the ATP, ADP, and Pi…
A: The objective of this question is to calculate the free energy of hydrolysis of ATP in a rat liver…
Q: ACTIVITY 10.7.1 Complete the table below for the gluconeogenesis with their corresponding precursor…
A: The metabolic process in the liver called "gluconeogenesis" creates glucose from precursors that are…
Q: Describe the amino acid composition in terms of the general characteristics and comment on what the…
A: Proteins are made up of around 20 standard and a few non-standard amino acids. Depending on the…
Q: Propose structures for intermediates A and B in the scheme below. This three-step conversion is…
A: Citrate is isomerized to isocitrate in the citric acid cycle via dehydration and rehydration. These…
Q: BIOMOLECULES - Please answer the questions properly. - Multiple choice 1. Which of the following…
A: OPTION A : It outlines an enzymatic two-step mechanism that converts AMP to ADP and subsequently ADP…
Q: Do Km and Vmax get affected by available enzyme concentration? Explain.
A: Enzymes are proteins that catalyse biochemical reactions. Michaelis Menten postulated that free…
Q: 4. Which amino acids do not react to produce a purple color with ninhydrin. Why?
A: Biological macromolecules are the molecules that are needed in a sufficient quantity for the…
Q: Why standard samples such as blue dextran/K2Cr2O7 are needed in isolation of alkaline phosphatase?
A: Alkaline phosphatases (ALPs) are a group of isoenzymes situated on the outer layer of the cell…
Q: Compute the free energy change in Joules that occurs at 303 K as the cell is tranitions from resting…
A: For free energy calculation, we can use the Nernst free energy equationi.e ΔG = -nF.ΔEWhere, ΔG =…
Q: What specific molecule gives rise to the stability and fluidity of the membrane and what are the…
A: The stability and fluidity of biological membranes primarily arises from the presence of…
Q: Use the appropriate equation to calculate the free energy change for the movement of Nat into the…
A: The Nernst equation, named after Walther Nernst, is a powerful tool in electrochemistry that relates…
Q: The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown…
A: The objective of the question is to identify the coding and template strands in the given DNA…
Q: What is the product of CH₂OH H-C-OH HO-C-H H-C-OH H-C-OH CH₂OH COOH H-C-OH HO-C-H I H-C-OH H-C-OH…
A: This is an example of reduction of a sugar with NADH/enzyme. The reaction of glucose with NADH is a…
Q: GQ7
A: The objective of the question is to identify the correct relationship between the two X chromosomes…
Q: To better understand how the lacR works, let's start let's approximate the volume of a bacterial…
A: The bacterial cell is considered as a cylInder. The equation to find volume of cylinder is ''.
Q: Draw the structure of phosphatidylcholine at pH 7 with the moiety on R₁ as 14:0 (C14) and R₂ as…
A: Glycerophospholipids, membrane lipids in which two fatty acids are attached in ester linkage to the…
Q: Which of the following is true of the difference between Class I and Class II B-lactamase…
A: Beta lactamase inhibitors are the substances or compounds that inhibit beta lactamase enzymes. Beta…
Q: 7. What is the driving force that promotes secondary structure formation of alpha helices and beta…
A: Two types of secondary structures are abundant in protein: alpha helix and beta sheets.The alpha…
Q: Monosaccharides are connected by _________ in polysaccharides. Chemically, these linkages are _____…
A: Monosaccharides are defined as the simplest sugars and are the basic unit of carbohydrates.…
Q: You are studying how your Lys-Val-Thr tripep de interacts with another pep de, which places an Asp…
A: Eventhough all ionizable groups have their characteristic pKa value, the pKa value of an ionizable…
Q: Find the structure of insulin online.Draw the tripeptide at the beginning of the Chain A and the…
A: Insulin is a peptide hormone composed of two polypeptide chains, usually referred to as Chain A and…
Q: Genetics Q4
A: The objective of the question is to find the sequence of the opposite strand of a given DNA strand.…
Q: 3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5' Table 22.4 mRNA…
A: The process of protein synthesis is also known as translation. The process of translation is…
Q: Draw a mechanism to account for the inter-strand cross linkage of two guanines by busulfan. Explain…
A: Busulfan is a drug used to treat cancer. It can form inter-strand crosslinks between guanine species…
Q: 24. Hexokinase catalyzes the phosphorylation of glucose from ATP, yielding glucose-6-P and ADP. The…
A: The objective of the question is to calculate the standard-state free energy change and equilibrium…
Q: Explain the biosynthesis of acetylcholine.
A: Acetyl choline is an amino alcohol which consists of a quaternary amino group, ethylene bridge and…
Q: . If 20 mM solution of Acetyl-phosphate is transformed to acetate by incubating with a catalytic…
A: Initially there was 20 mM acetyl-phosphate. At equilibrium, the acetyl-phosphate concentration…
Q: How are these the same and different.
A: Monosaccharides are the smallest functional and structural units of carbohydrates. They have the…
Q: Which factor contributes to the selectivity pore of the potassium channel from S. lividans? O…
A: S lividans stands for Streptomyces lividans. It is a gram positive & filamentous bacterium that…
Q: Draw the major organic product of the following reaction: 1. (CH3CH2)2NH, H+ (cat.) 2. о H 3. H3O+
A: In the reaction of Cyclopentanone the major product will be a ketone which is…
Q: 4. How do embryonic and adult stem cells differ?
A: The objective of this question is to understand the differences between embryonic stem cells and…
Q: 1. The first step in the payoff phase of glycolysis is catalyzed by the enzyme glyceraldehyde…
A: Gluconeogenesis is the metabolic pathway by which glucose is synthesised from the sources like…
Q: The structures of the amino acids leucine and isoleucine are shown: H N-C-C CH₂ CH HỌC CH, Leucine H…
A: A protein's function depends on its structure. There are four levels of protein structure: primary,…
Q: A) H H₂N-C-C <=0 CH2 OH ОН н D) H2N-C-C <=0 CH2 OH HO CH3 B) H₂N-C H3C-CH CH2 CH3 0= OH E) H2N-c-c С…
A: Amino acids are simply an alpha-carbon bonded to 4 different groups. The 4 groups are;an alpha-amino…
Q: Directions: Answer the following as directed: vinu oto de 00 200nsko2 brs 2nA lo epello 1. After…
A: Amino acids are building blocks of proteins, which have three different chemical groups: an amino…
Q: What are the biological actions of enzymes ? What reactions do they catalyze? please include…
A: 1. Overview of Enzymes: Since they catalyze chemical reactions in living things without being…
Q: Week 8 Q1
A: The objective of this question is to understand the concept of translocation in genetics and to…
Q: In the following scheme: HNH, IT H,C-C-C-Coo II H HO 1 O NH, 1 H₂C-C-C-COOⓇ H 2-Amino-3-ketobutyrate…
A: Metabolism consists of catabolism and anabolism. Catabolism refers to the breakdown of compound to…
Q: Biochemistry...Represent the reactions when Phosphatidylethanolamine was treated with; (I)…
A: Phosphatidylethanolamine (PE) is a type of phospholipid found in cell membranes. It consists of a…
Q: In N-linked glycoproteins, the sugar molecule is usually bound to a Asp b Ser c Asn d Thr
A: Glycoproteins are conjugated biomolecules where a protein is covalently bound to a carbohydrate…
Q: The image below is from what stage a) Prophase b) Interphase c) Telophase d) Metaphase e) Anaphase
A: Cell division typically involves two main stages: mitosis and cytokinesis. Here's a brief overview…
Q: The enzyme that catalyzes the formation of the peptide bond is located: in the large ribosomal…
A: During translation amino acids get linked to each other via peptide bonds. The enzyme responsible…
Q: The protein catalase catalyzes the reaction 2 H,O,(aq) — 2 H₂O(1) + O₂(g) S and has a…
A: Reaction: 2H₂O₂(aq) → 2H2O(l) + O2(g)Km = 25 mMTurnover number Kcat = 4.0 × 107s–1Total enzyme…
Q: Red blood cells synthesize and degrade 2,3-biphosphogylerate (2,3-BPG) as a detour from the…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate. It…
Q: The cell above is in a) Meiosis 2 b) Mitosis c) Meiosis 1
A: During anaphase II of meiosis:The sister chromatids, which were held together by cohesin proteins at…
Q: 1. In a study by Cameroni et al. (Nature, Dec. 2021), scientists analyzed the interaction between…
A: SARS-CoV-2 is an infectious virus that is responsible for the recent COVID pandemic. It is a…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- Using the ActiveModel for aldose reductase, describe the structure of the TIM barrel motif and the structure and location of the active site.Palmitoleic acid, 16:1Δ⁹ hexadecaenoic acid, (16 carbon FA with one double bond )is an important fatty acid component of TAGs and cell membranes. Briefly explain the process of beta oxidation of this fatty acid and the number (only) of FADH, NADH and acetyl CoA outcome. What is the total ATP (only number) generated from this fatty acid after beta oxidation.Consider docosanoic acid C12H43CO2H a. Label the alpha and beta Carbons. Show the beta-oxidation in an EXPANDED structure. b. Draw each acyl CoA derived from this fatty acid. c. How many acetyl Co A molecules are formed by complete beta-oxidation? d. How many cycles of beta-oxidation are needed for complete oxidation? e. How many molecules of ATP are formed from the complete catabolism of this fatty acid? Show the complete computation. f. How many moles of ATP per gram of fatty acid is formed from the complete catabolism of the given fatty acid? g. What is the molar mass of the given fatty acid? Solution: Show here the complete computations, [from a to e]
- Worksheet on Computation of ATP yield from Fatty acid metabolism. Consider docosanoic acid, C21H43CO2H a. Label alpha (a) and beta ( B) carbons b. Draw the acyl COA derived from this fatty acid c. How many acetyl CoA molecules are formed by complete B-oxidation? d. How many cycles of B- oxidation are needed for complete oxidation? e. How many molecules of ATP are formed from the complex catabolism of this fatty acid.Considering the complete oxidation of an 18-C fatty acid. Give the answer for the following question.a. How many rounds of beta-oxidation is needed?b. How many NADH molecules are produced in beta-oxidation only?c. How many FADH2 molecules are produced in beta-oxidation only?d. How many Acetyl Co-A are produced?Consider decosanoic acid C12H43CO2H SUB PART TO BE SOLVED How many cycles of beta-oxidation are needed for complete oxidation? How many molecules of ATP are formed from the complete catabolism of this fatty acid? Show the complete computation. How many moles of ATP per gram of fatty acid is formed from the complete catabolism of the given fatty acid? What is the molar mass of the given fatty acid? Solution: Show here the complete computations, [from 1 to 4]
- What is the catalytic efficiency of Catalase ? Table. The values of KM and kcat for some Enzymes and Substrates Enzyme Carbonic anhydrase Substrate CO2 HCO3 KM (M) 1.2 x 10-2 2.6 x 10-2 Kcat (s-1) 1.0 x 106 4.0 x 105 Catalase H2O2 2.5 x 10-2 1.0 x 107 Urease Urea 2.5 x 10-2 4.0 x 105 O A. 4 x 108 M-s-1 O B. 4 x 108 M-1.s-1 OC25x 10-9 M-s1 D. 2.5 x 102 M-1.s-1 OE 1.0 x 107 s1Draw the product of the dehydration reaction of the B- hydroxyacyl-SACP catalyzed by B-hydroxyacyl-ACP dehydratase (DH) in the third elongation step of fatty acid synthesis. Provide the structure in the protonation state found in physiological conditions. OH B-hydroxyacyl-ACP dehydratase (DH) O Drawing SACP Q. Pyruvate can be processed under anaerobic conditions to ethanol (in yeast) or to lactate (in mammals), as shown. Explain the primary purpose of these reactions. Describe the major biochemical features of each reaction
- Calculate the total number of ATP that can be generated from the ß-oxidation of paulinic acid? ОН 1. How many ATP expended for activating fatty acid to fatty acyl-CoA? How many rounds of beta oxidation? How many FADH2 per round of beta oxidation? Is there any point in the beta oxidation of an unsaturated fatty acid where we skip over FADH, production? How many FADH, total from beta oxidation? How many NADH per round of beta oxidation? How many NADH total from beta oxidation? How many acetyl-CoA are produced through beta oxidation? 6. 2. 3. 4. 5. How many NADH and FADH, are produced per acetyl-CoA in the citric acid cycle? How many NADH total from all acetyl-CoA running through the citric acid cycle? How many FADH, total from all acetyl-CoA running through the citric acid cycle? How many ATP are produced per acetyl-CoA in the citric acid cycle? How many ATP total from all acetyl-CoA running through the citric acid cycle? How many ATP per NADH,? 9. 7. 1. 8. How many ATP per FADH,? 10.…Consider the complete oxidation of one mole of simple TAG containing behenic acid residues (22:0). II. What is the net ATP yield for the complete oxidation of all the fatty acid residues of the simple TAG? (Note: glycerol backbone is not included)ATP Accounting Upon digestion of starch, maltose, one of its degradation products, is further hydrolyzed into its monosaccharide components prior to intestinal absorption and entry into the glycolysis. Calculate the number of ATP molecules produced from the digestion and complete oxidation of 3 molecules of maltose considering the malate-aspartate shuttle. Answer the following items using numerical value only (e.g. 1, not "1 ATP") which will help you arrive at the final answer for this question. a. Total number of glucose molecules entering glycolysis: b. Total number of pyruvate molecules produced at the end of glycolysis: c. Total number of mitochondrial NADH produced after pyruvate is acted upon by the pyruvate dehydrogenase complex: d. Total number of CO2 released right after the pyruvate dehydrogenase complex reaction: e. Total number of acetyl CoA molecules entering the citric acid cycle: f. Total number of net cytosolic ATP molecules produced right after glycolysis: g. Total…